National Fruit Fly Diagnostic Protocol - IPPC.int

THE AUSTRALIAN HANDBOOK 

FOR THE IDENTIFICATION OF 

FRUIT FLIES 

Version 1.0 

Species: Bactrocera bryoniae Species: Bactrocera frauenfeldi Species: Bactrocera kandiensis Species: Bactrocera tau 

Species: Bactrocera trilineola Species: Bactrocera umbrosa Species: Bactrocera xanthodes Species: Bactrocera newmani

For more information on Plant Health Australia 

Phone: +61 2 6215 7700 

Fax: +61 2 6260 4321 

Email: biosecurity@phau.com.au 

Visit our website: www.planthealthaustralia.com.au 

An electronic copy of this plan is available from the website listed above. 

© Plant Health Australia 2011 

This work is copyright except where attachments are provided by other contributors and referenced, in 

which case copyright belongs to the relevant contributor as indicated throughout this document. Apart 

from any use as permitted under the Copyright Act 1968, no part may be reproduced by any process 

without prior permission from Plant Health Australia. 

Requests and enquiries concerning reproduction and rights should be addressed to: 

Communications Manager 

Plant Health Australia 

1/1 Phipps Close 

DEAKIN ACT 2600 

ISBN 978-0-9872309-0-4 

In referencing this document, the preferred citation is: 

Plant Health Australia (2011). The Australian Handbook for the Identification of Fruit Flies. Version 

1.0. Plant Health Australia. Canberra, ACT. 

Disclaimer: 

The material contained in this publication is produced for general information only. It is not intended 

as professional advice on any particular matter. No person should act or fail to act on the basis of any 

material contained in this publication without first obtaining specific, independent professional advice. 

Plant Health Australia and all persons acting for Plant Health Australia in preparing this publication, 

expressly disclaim all and any liability to any persons in respect of anything done by any such person 

in reliance, whether in whole or in part, on this publication. The views expressed in this publication are 

not necessarily those of Plant Health Australia.

1 Contributors 

This document has been made possible through consultation with and input from the following fruit fly 

entomologists, scientists, academics and diagnosticians: 

Organisation Contributor 

Australian Government, Department of Agriculture, 

Fisheries and Forestry 

CRC for National Plant Biosecurity Gary Kong 

CSIRO David Yeates 

Jacek Plazinski, Kerry Huxham, Anthony Rice, Glenn 

Bellis, Bart Rossel, James Walker, Sally Cowan, 

Vanessa Findlay, David Daniels 

Department of Agriculture and Food, Western Australia Andras Szito, Darryl Hardie 

Department of Employment, Economic Development 

and Innovation, Queensland 

Department of Primary Industries, Parks, Water and 

Environment, Tasmania 

Jane Royer, Suzy Perry, Shaun Winterton, Harry Fay 

Lionel Hill 

Department of Primary Industries, Victoria Jane Moran, Mali Malipatil, Linda Semeraro, 

Mark Blacket 

Department of Resources, Northern Territory Stuart Smith, Deanna Chin, Stephen West, 

Brian Thistleton 

Griffith University Dick Drew 

Industry and Investment New South Wales Peter Gillespie, Bernie Dominiak, Deborah Hailstones 

Margaret Williams Plant Health Services Margaret Williams 

Primary Industries and Resources, South Australia Cathy Smallridge, John Hannay 

Queensland University of Technology Tony Clarke 

South Australian Museum Mark Adams 

Private consultant David Hancock 

1

2 Foreword 

The accurate identification of fruit flies is a key component of Australia’s 

biosecurity system that underpins the domestic movement of fruit and 

vegetables, maintains international market access for Australian producers 

and protects Australia’s borders from exotic pest incursion. 

In Australia’s tropics, routine surveillance of coastal and island communities 

results in a requirement to process and identify thousands of adult flies per 

hour. In some parts of southern Australia fruit fly sampling numbers are 

smaller, however diagnosticians still have to be skilled and equipped to 

identify a single fly of economic importance amongst a large range of native 

fruit flies that have no impact on commercial fruits and vegetables. 

For the first time a document has been produced that integrates all the diagnostic techniques currently 

used in Australia for the identification of fruit flies. A new set of descriptions and photographs have been 

prepared to assist the identification of flies by adult morphology. In addition, current protocols used for 

the identification of fruit flies using molecular biology techniques are presented. 

This document has been written by Australia’s fruit fly diagnosticians for diagnosticians and it is my 

hope that the dialogue, sharing of information and experience, and constructive discourse that has 

resulted in this new publication will continue to grow. Together the combined expertise and knowledge 

of Australia’s fruit fly researchers, academics, surveillance officers, diagnosticians and laboratory 

scientists make up a formidable national resource, which when networked and coupled with extensive 

fruit fly reference collections, provides a world-class national capability. 

This valuable document provides a useful benchmark against which future updates and revisions can 

be developed and training programs can be delivered. 

I would like to thank all the entomologists and scientists who have brought this document together and 

have the greatest pleasure in endorsing its adoption and use by practitioners and jurisdictions in 

Australia. 

Professor Dick Drew 

International Centre for Management of Pest Fruit Flies 

Griffith University 

2

3 Preface 

The Australian Handbook for the Identification of Fruit Flies (v1.0) 

• Was written by diagnosticians for diagnosticians; 

• Collates current and existing practices and knowledge into a single document; 

• Pools experience from Australia’s network of fruit fly experts; 

• Establishes a resource that can support and develop the confidence and expertise of all users; 

• Provides a mechanism to possibly identify future information and research needs; and, 

• Considers the potential of both morphological and molecular techniques. 

The Handbook has been an important part of building a network of fruit fly diagnosticians across 

Australia and it is hoped that both the network and this document continue to grow and develop in the 

future. We also welcome feedback from fruit fly experts around the world. 

The Handbook is a compilation of diagnostic techniques for some 47 fruit fly species, most of which are 

exotic to Australia. The Handbook is intended to facilitate rapid diagnosis of fruit fly species and be a 

comprehensive guide for Australian diagnosticians and field officers. 

A copy of the Handbook can be downloaded by following the link below. 

http://www.phau.com.au/go/phau/strategies-and-policy 

This is the first version of The Australian Handbook for the Identification of Fruit Flies. It is provided 

freely as a reference resource with an expectation that it is appropriately acknowledged when it is 

used. As a living document it is designed to be continuously updated as more information becomes 

available through Australia’s skilled network of fruit fly diagnosticians. For further information please 

contact the Office of the Chief Plant Protection Officer (OCPPO), Department of Agriculture, Fisheries 

and Forestry. Email: ocppo@daff.gov.au. 

Funding for this important initiative was provided by the Australian Government. The Office of the Chief 

Plant Protection Officer would like to recognise the huge contribution made by researchers, academics, 

surveillance officers, diagnosticians and laboratory scientists who have collectively brought this valuable 

document into being. Thanks are also extended to Plant Health Australia for facilitating and coordinating 

the preparation of the Handbook. 

Lois Ransom 

Chief Plant Protection Officer 

December 2011 

3

Contents 

1 Contributors ...................................................................................................................................... 1 

2 Foreword ........................................................................................................................................... 2 

3 Preface ............................................................................................................................................... 3 

4 Introduction....................................................................................................................................... 6 

4.1 Background ............................................................................................................................... 6 

4.2 Coverage of this diagnostic handbook ..................................................................................... 7 

5 Detection ........................................................................................................................................... 9 

5.1 Plant products affected ............................................................................................................. 9 

5.2 Signs and symptoms ................................................................................................................ 9 

5.3 Development stages ................................................................................................................. 9 

5.4 Methods for detection ............................................................................................................. 10 

5.4.1 Trap types ......................................................................................................................... 10 

5.4.2 Attractants ......................................................................................................................... 12 

5.5 Inspection of material, sample preparation and storage ........................................................ 13 

6 Identification ...................................................................................................................................14 

6.1 Overview ................................................................................................................................. 14 

6.2 Morphological identification .................................................................................................... 18 

6.2.1 Procedure.......................................................................................................................... 18 

6.2.2 Identification ...................................................................................................................... 19 

6.3 PCR – based identification ..................................................................................................... 23 

6.3.1 Restriction Fragment Length Polymorphism ..................................................................... 23 

6.3.2 DNA barcoding of tephritid fruit flies ................................................................................. 43 

6.4 Allozyme electrophoresis ........................................................................................................ 49 

6.4.1 Aim .................................................................................................................................... 49 

6.4.2 Targets .............................................................................................................................. 49 

6.4.3 Suitability ........................................................................................................................... 49 

6.4.4 Procedure overview .......................................................................................................... 49 

7 Diagnostic Information ..................................................................................................................52 

7.1 Simplified key to major pest fruit fly genera (after White and Elson-Harris 1992) .................. 52 

7.2 Guide to PCR-RFLP molecular information ............................................................................ 53 

7.3 Bactrocera .............................................................................................................................. 54 

7.3.1 Bactrocera (Bactrocera) albistrigata (de Meijere) ............................................................. 54 

7.3.2 Bactrocera (Bactrocera) aquilonis (May) .......................................................................... 57 

7.3.3 Bactrocera (Paratridacus) atrisetosa (Perkins) ................................................................. 61 

7.3.4 Bactrocera (Bactrocera) bryoniae (Tryon) ........................................................................ 64 

7.3.5 Bactrocera (Bactrocera) carambolae Drew and Hancock ................................................ 67 

7.3.6 Bactrocera (Bactrocera) caryeae (Kapoor) ....................................................................... 70 

7.3.7 Bactrocera (Bactrocera) correcta (Bezzi) ......................................................................... 72 

7.3.8 Bactrocera (Austrodacus) cucumis (French) .................................................................... 75 

7.3.9 Bactrocera (Zeugodacus) cucurbitae (Coquillett) ............................................................. 78 

7.3.10 Bactrocera (Bactrocera) curvipennis (Froggatt)................................................................ 81 

7.3.11 Bactrocera (Paradacus) decipiens (Drew) ........................................................................ 84 

7.3.12 Bactrocera (Bactrocera) dorsalis (Hendel) ....................................................................... 87 

4

7.3.13 Bactrocera (Bactrocera) facialis (Coquillett) ..................................................................... 91 

7.3.14 Bactrocera (Bactrocera) frauenfeldi (Schiner) .................................................................. 94 

7.3.15 Bactrocera (Afrodacus) jarvisi (Tryon) .............................................................................. 97 

7.3.16 Bactrocera (Bactrocera) kandiensis Drew and Hancock ................................................ 100 

7.3.17 Bactrocera (Bactrocera) kirki (Froggatt) ......................................................................... 102 

7.3.18 Bactrocera (Bactrocera) kraussi (Hardy) ........................................................................ 105 

7.3.19 Bactrocera (Bactrocera) latifrons (Hendel) ..................................................................... 107 

7.3.20 Bactrocera (Bactrocera) melanotus (Coquillett) .............................................................. 109 

7.3.21 Bactrocera (Bactrocera) musae (Tryon) ......................................................................... 111 

7.3.22 Bactrocera (Bactrocera) neohumeralis (Hardy) .............................................................. 114 

7.3.23 Bactrocera (Bactrocera) occipitalis (Bezzi) ..................................................................... 117 

7.3.24 Bactrocera (Bactrocera) papayae Drew and Hancock ................................................... 120 

7.3.25 Bactrocera (Bactrocera) passiflorae (Froggatt) .............................................................. 123 

7.3.26 Bactrocera (Bactrocera) philippinensis Drew and Hancock ........................................... 126 

7.3.27 Bactrocera (Bactrocera) psidii (Froggatt) ........................................................................ 129 

7.3.28 Bactrocera (Zeugodacus) tau (Walker) ........................................................................... 132 

7.3.29 Bactrocera (Bactrocera) trilineola Drew .......................................................................... 135 

7.3.30 Bactrocera (Bactrocera) trivialis (Drew) .......................................................................... 138 

7.3.31 Bactrocera (Bactrocera) tryoni (Froggatt) ....................................................................... 141 

7.3.32 Bactrocera (Bactrocera) umbrosa (Fabricius) ................................................................. 145 

7.3.33 Bactrocera (Notodacus) xanthodes (Broun) ................................................................... 148 

7.3.34 Bactrocera (Bactrocera) zonata (Saunders) ................................................................... 151 

7.4 Ceratitis ................................................................................................................................. 154 

7.4.1 Ceratitis capitata (Wiedemann)....................................................................................... 154 

7.4.2 Ceratitis (Pterandrus) rosa Karsch.................................................................................. 157 

7.5 Dirioxa ................................................................................................................................... 160 

7.5.1 Dirioxa pornia (Walker) ................................................................................................... 160 

7.6 Anastrepha ........................................................................................................................... 162 

7.6.1 Anastrepha fraterculus (Wiedemann) ............................................................................. 162 

7.6.2 Anastrepha ludens (Loew) .............................................................................................. 165 

7.6.3 Anastrepha obliqua (Macquart)....................................................................................... 168 

7.6.4 Anastrepha serpentina (Wiedemann) ............................................................................. 171 

7.6.5 Anastrepha striata Schiner .............................................................................................. 174 

7.6.6 Anastrepha suspensa (Loew) ......................................................................................... 176 

7.7 Rhagoletis ............................................................................................................................. 179 

7.7.1 Rhagoletis completa Cresson ......................................................................................... 179 

7.7.2 Rhagoletis fausta (Osten-Sacken) .................................................................................. 181 

7.7.3 Rhagoletis indifferens Curran ......................................................................................... 183 

7.7.4 Rhagoletis pomonella (Walsh) ........................................................................................ 185 

8 Diagnostic resources ...................................................................................................................187 

8.1 Key contacts and facilities .................................................................................................... 187 

8.2 Reference collections ........................................................................................................... 189 

8.3 Printed and electronic resources .......................................................................................... 190 

8.3.1 Morphological keys ......................................................................................................... 190 

8.3.2 Electronic resources ....................................................................................................... 191 

8.4 Supplier details ..................................................................................................................... 192 

9 References ....................................................................................................................................193 

10 Appendices ...................................................................................................................................196 

5

4 Introduction 

Fruit flies are one of the world’s most destructive horticultural pests and pose risks to most commercial 

fruit and vegetable crops. This has major implications for the sustainable production and market access 

of Australia’s $4.8 billion horticultural industry. Worldwide there are some 4,000 species of fruit flies in 

the family Tephritidae of which around 350 species are of economic importance. 

More than 280 species of fruit fly are endemic to Australia although only seven of these have been 

found to have significant economic impact. It is therefore important to be able to distinguish between 

those endemic species that pose a threat to production and domestic market access from those that do 

not. 

Furthermore, Australia is free from many species that impact production elsewhere. Neighbouring 

countries in Southeast Asia and the South Pacific are home to numerous species of fruit fly that pose an 

immediate incursion risk to Australian quarantine. Rapid diagnosis of these flies should they arrive in 

Australia is therefore critical to containing and eradicating the populations before they establish. 

Although a range of diagnostic methods are available that can be undertaken by a number of 

laboratories in Australia, there has not been an established agreement on (a) the number and type of 

tests that should be conducted to establish a positive identification, (b) the exact protocols that should 

be followed for specific diagnostic tests and, (c) agreement on the number and type of protocols that 

should be retained and maintained to facilitate a diagnosis at short notice. 

This project was therefore undertaken to establish an agreed national standard that is able to facilitate 

rapid diagnosis and streamline a national response when suspected incursions occur, and include 

taxonomic identifications using morphological and molecular approaches. 

PHA would like to acknowledge the support, encouragement and professional advice contributed by all 

participants to this process. 

4.1 Background 

Australia has a strong, internationally recognised capacity to diagnose fruit fly species and maintains a 

wide network of fruit fly traps as part of a national surveillance system. From the Northern Territory and 

the Torres Strait Islands to Tasmania, and from Perth to Melbourne, significant expertise is maintained 

in state and federal government departments, universities and in the private sector to support the 

identification of fruit fly species. 

Supported by an extensive world class fruit fly collection (albeit split across various interstate locations), 

Australia is fortunate to have a group of entomologists and other scientists with extensive experience 

and knowledge of fruit fly diagnostics. 

Not surprisingly, given the range of endemic and exotic fruit flies that can be encountered in different 

climatic zones, many jurisdictions have developed specialist expertise to identify species pertinent to 

regional production and quarantine requirements. 

Against this background this project was undertaken to establish a diagnostic procedure that has a 

national focus and can assist all stakeholders to maintain the strongest capability to identify fruit flies. 

This project also provides an opportunity to: 

• collate current (existing) practices and knowledge base into a single document 

• pool experience from all of Australia’s experts in a collegiate manner 

• facilitate and improve the constructive exchange of ideas and material across jurisdictions and 

entities 

6

• establish a resource that can support and develop the confidence and expertise of all users 

• provide a mechanism to possibly identify future information and research needs, and 

• consider the potential of both morphological and molecular techniques as they are developed 

and become available 

4.2 Coverage of this diagnostic handbook 

To develop this document, a review was firstly conducted to establish those fruit fly species being 

targeted by jurisdictions in their current surveillance programs. These species were also reviewed 

against diagnostic tools (e.g. electronic and internet keys) already available and in use to support 

routine diagnosis. This review enabled the development of a proposed species list to be covered by this 

national protocol (Table 1) 

7

Table 1. Fruit flies covered in this diagnostic handbook 

Scientific name Common name Scientific name Common name 

Anastrepha fraterculus South American fruit fly Exotic Bactrocera latifrons Solanum fruit fly Exotic 

Anastrepha ludens Mexican fruit fly Exotic Bactrocera melanotus Exotic 

Anastrepha obliqua West Indian fruit fly Exotic Bactrocera musae Banana fruit fly Present in Australia 

Anastrepha serpentina Sapote fruit fly Exotic Bactrocera neohumeralis Lesser Queensland fruit fly Present in Australia 

Anastrepha striata Guava fruit fly Exotic Bactrocera occipitalis Exotic 

Anastrepha suspensa Caribbean fruit fly Exotic Bactrocera papayae Papaya fruit fly Exotic 

Bactrocera albistrigata Exotic Bactrocera passiflorae Fijian fruit fly Exotic 

Bactrocera aquilonis Northern Territory fruit fly Exotic Bactrocera philippinensis Philippines fruit fly Exotic 

Bactrocera atrisetosa Exotic Bactrocera psidii South sea guava fruit fly Exotic 

Bactrocera bryoniae Present in Australia Bactrocera tau Exotic 

Bactrocera carambolae Carambola fruit fly Exotic Bactrocera trilineola Exotic 

Bactrocera caryeae Exotic Bactrocera trivialis Exotic 

Bactrocera correcta Guava fruit fly Exotic Bactrocera tryoni Queensland fruit fly Present in Australia 

Bactrocera cucumis Cucumber fruit fly Present in Australia Bactrocera umbrosa Breadfruit fruit fly Exotic 

Bactrocera cucurbitae Melon fly Exotic Bactrocera xanthodes Pacific fruit fly Exotic 

Bactrocera curvipennis Exotic Bactrocera zonata Peach fruit fly Exotic 

Bactrocera decipiens Pumpkin fruit fly Exotic Ceratitis capitata Mediterranean fruit fly Present in Australia 

Bactrocera dorsalis Oriental fruit fly Exotic Ceratitis rosa Natal fruit fly Exotic 

Bactrocera facialis Exotic Dirioxa pornia Island fly Present in Australia 

Bactrocera frauenfeldi Mango fruit fly Present in Australia Rhagoletis completa Walnut husk fly Exotic 

Bactrocera jarvisi Jarvis's fruit fly Present in Australia Rhagoletis fausta Black cherry fruit fly Exotic 

Bactrocera kandiensis Exotic Rhagoletis indifferens Western cherry fruit fly Exotic 

Bactrocera kirki Exotic Rhagoletis pomonella Apple maggot Exotic 

Bactrocera kraussi Present in Australia 

8

5 Detection 

5.1 Plant products affected 

Fruit flies can infest a wide range of commercial and native fruits and vegetables. Lists of hosts are 

provided in the data sheets contained in Section 7. 

Fruit is increasingly likely to be attacked as it becomes more mature and as the fruit fly population 

increases during summer and autumn. A wide range of fruits are potentially vulnerable to fruit fly 

attack. In urban home gardens, and in orchards close to urban areas, fruit fly populations are often 

much higher than in outlying orchards. 

Plant parts liable to carry the pest in trade or transport include fruiting bodies, in which eggs or larvae 

can be borne internally. The illegal movement or smuggling of non-commercially produced fruit is the 

major risk pathway for exotic fruit fly incursions (CABI 2007). 

5.2 Signs and symptoms 

The oviposition-site punctures in the fruit are commonly referred to as ‘stings’. Stings are usually 

identified by making a shallow cut through the skin of the fruit and looking for the egg cavity containing 

eggs, larvae or the remains of hatched eggs. In fruits such as peaches, the stings are not very 

noticeable, while in pale, smooth-skinned fruits, the sting mark may be easily detected and can 

disfigure the fruit when marked by ‘gum bleed’. Some fruits, such as avocado and passionfruit, 

develop hard, thickened areas where they are stung. In mature citrus, the sting mark may be a small 

brown depressed spot, or have an indistinct, bruised appearance, while on green citrus fruit the skin 

colours prematurely around the sting mark. In humid conditions, the fungi responsible for green mould 

in citrus and brown rot in stone fruit will readily infect stung fruit. 

Fruit will fall from the tree as a result of larval infestation. The extent of the damage caused by larvae 

tunnelling through fruit varies with the type and maturity of the fruit, the number of larvae in it, and the 

prevailing weather conditions. Larvae burrow towards the centre in most fruits, with internal decay 

usually developing quickly in soft fruits. In hard fruits a network of channelling is usually seen, followed 

by internal decay. Larval development can be very slow in hard fruits such as Granny Smith apples. 

5.3 Development stages 

The following life history, from McKenzie et al. (2004), is based on the much studied Queensland fruit 

fly but is also relevant to most other fruit flies, although differences may occur with regard to host 

preference and the relationship between developmental rate and temperature. 

Typically, fruit flies lay their eggs in semi-mature and ripe fruit. The female fruit fly has a retractable, 

sharp egg-laying appendage (the ovipositor) at the tip of the abdomen that is used to insert up to six 

eggs into a small chamber about 3 mm under the fruit skin. 

Tephritid fruit fly eggs are white, banana shaped and nearly 1mm long. Infested fruit may show ‘sting’ 

marks on the skin and may be stung more than once by several females. In 2 or 3 days larvae 

(maggots) hatch from the eggs and burrow through the fruit. To the naked eye, the larvae resemble 

blowfly maggots. They are creamy white, legless, blunt-ended at the rear and tapered towards the 

front where black mouth hooks (cephalopharyngeal skeleton) are often visible. Female flies may have 

an association with bacteria resident in their gut in some regions of Australia, which they regurgitate 

onto the fruit before ovipositing (see Appendix 1). Most of the damage sustained by the fruit is actually 

caused by the bacteria and the maggots simply lap up the juice. 

9

A pair of mouth hooks allows the larvae to readily tear the fruit flesh. The larvae develop through three 

larval stages to become about 9 mm long and pale yellow when fully grown. Several larvae can 

develop in each fruit, and when fully developed they leave the fruit, falling to the soil beneath the tree 

and burrowing down about 5 cm to form a hard, brown, barrel-like pupal case from its own skin where 

it completes its development. Many flies leave the fruit while it is already on the ground. Most insects 

cannot pupate successfully in the presence of excess moisture and fruit flies have a prepupal stage 

when they can 'flick' themselves over some distance, presumably to distance themselves from the 

host fruit. 

The duration of pupal developmental is dependent on temperature with each stage taking from 9 days 

to several weeks to complete. Adult flies emerge from their pupal cases in the soil and burrow towards 

the surface where they inflate their wings and fly away. Adults are able to mate within a week of 

emerging, living for many weeks with females continuing to lay eggs throughout their lifecycle. Adult 

fruit flies feed on carbohydrates from sources such as fruit and honeydew, the sweet secretion from 

aphids and scale insects, as well as natural protein sources, including bird droppings and bacteria. 

Fruit fly larvae can be attacked by parasitoids although they appear to have little impact on 

populations of most fruit flies, with 0-30% levels of parasitism typical (CABI 2007). However, mortality 

due to vertebrate consumption of infested fruit can be very high, as can pupal mortality in the soil, 

either due to predation or environmental factors. 

5.4 Methods for detection 

Monitoring is largely carried out by setting traps in areas of interest. However, there is evidence that 

some fruit flies have different host preferences in different parts of their range (CABI 2007). As such, 

host fruit surveys may be required in the event of an exotic incursion. Where known, specific lures are 

provided for each species in the data sheets contained in Chapter 4. The following information and 

images are taken from Lawson et al. (2003). 

5.4.1 Trap types 

LYNFIELD TRAP 

The Lynfield lure trap (see Figure 1a) is a non-sticky disposable pot type trap for adult male flies. It 

consists of a modified clear plastic container, e.g. a 1 litre container with a 100 mm base, a 90 mm 

diameter top and depth 115 mm. There are four entry holes 25 mm in diameter evenly spaced 15 mm 

below the lip of the trap. 

Cotton wicks containing the liquid lure are held together with a wire clip and hung from a wire loop 

under the lid of the trap. 

Like the Lynfield and Paton traps, the hook holding the wick is formed by a wire inserted through the 

centre of the lid which extends about 25 cm above it so that it can be attached to the branch of a tree, 

allowing the trap to hang freely. A poison and information label is placed onto the trap body. 

This trap is used in drier areas of Australia (eg. Townsville). 

STEINER TRAP 

The Steiner trap (see Figure 1b) is basically an open horizontal plastic cylinder within which a cotton 

wick impregnated with a mixture of attractant and insecticide is suspended. 

This type of trap provides the flies with easy access into the trap whilst giving them protection from 

water and predator damage. They are popular in areas of high rainfall such as far north Queensland. 

The large openings at each end of the trap also allow the free movement of the attractant vapour from 

10

the cotton wick. The cotton dental wicks provide absorption of the attractant and insecticide mix, yet 

still allow evaporation of the lure over relatively long periods, and are inexpensive. 

PATON TRAP 

The Paton trap (see Figure 1c) is used in areas of high rainfall or wind or where traps may be set 

longer periods (eg a month) between collections. They are generally used on Cape York Peninsula 

and the Torres Strait Islands in Queensland. They are very rain resistant, prevent flies falling out in 

windy situations and are able to hold about 10 000 flies (where the Steiner can only hold about 6000). 

They also have a wick impregnated with attractant and insecticide and labels on the outside (Poison, 

lure type, contact info) as per Lynfield and Steiner. They are often used with cardboard spacers to 

maintain the samples in good condition. 

MCPHAIL TRAP 

The McPhail trap (see Figure 1d) is essentially a glass or plastic flask-shaped container with an 

invaginated entrance at the base. It attracts both male and female flies to the trap, but in far fewer 

numbers than those which use male lures alone. It can be useful in attracting species that do not 

respond to male lures. Liquid attractants such as fruit juices and proteinaceous solutions are used to 

both attract and kill the flies (by drowning). These traps only catch a small number of flies due to the 

short range of attraction. They need to be cleared regularly to avoid deterioration of the specimens 

and to maintain their efficacy. 

Figure 1. Types of fruit fly traps 

(a) Lynfield trap (Image courtesy of NSW 

I&I) 

(b) Steiner trap 

11

(c) Paton trap (Image courtesy of AQIS) (d) McPhail trap 

5.4.2 Attractants 

Attractants or lures are commonly used to trap fruit flies as they provide an easy way to collect large 

numbers of flies in a short period of time. 

Food-based attractants, such as those used in McPhail traps, were widely used in the past. These are 

still in use today as they offer the advantage of attracting both sexes of many species, including those 

not attracted to male lures. 

Males of many species respond to chemicals referred to as parapheromones. These lures attract flies 

from large distances. Cue lure (CUE) (Figure 2a) and methyl eugenol (ME) (Figure 2b) are two male 

attractants widely used in collecting Bactrocera spp. fruit flies. Most species appear to be attracted to 

one lure or the other, however other species are attracted to a combination of both lures (Dominiak et 

al., 2011) (see Appendix 2). It should be noted that one of the breakdown products of CUE, raspberry 

ketone or Willison’s lure, is itself an attractant (Metcalf et al., 1983). Trimedlure/capilure is used to trap 

Ceratitis spp. All three lures are used in Lynfield and Steiner traps. Only ME and CUE are used in 

Paton traps in Australia (because these traps are used in the tropics and Ceratitis spp. cannot 

establish there). 

Figure 2. Chemical structure of cue lure and methyl eugenol 

(a) Cue lure (b) Methyl eugenol 

Attractants are generally highly volatile chemicals and need only to be used in small amounts to be 

effective. Generally, a wick is impregnated with a mixture of 4 mL attractant and 1 mL or less of 50% 

w/v concentrate of malathion or dichlorvos and is then suspended within the trap. It is very important 

that lure contamination does not occur along any step of the way from when the wicks are prepared 

through to when the traps are emptied. If this occurs then flies that are attracted to one lure may also 

end up in traps containing flies attracted to another. This can lead to confusion during identification. 

12

5.5 Inspection of material, sample preparation and storage 

Fruits (locally grown or samples of fruit imports) should be inspected for puncture marks and any 

associated necrosis. Suspect fruits should be cut open and checked for larvae. Infested fruit should be 

held in a container which has a gauze cover to allow aeration. Pupae need to develop in a dry medium 

such as sand or sawdust. Once flies start to emerge they need to be provided with access to water 

and sugar for survival and for colour development. After about 4 days they may be collected, killed 

and prepared for study (Lawson et al. 2003). 

Fruit fly adults, larvae and eggs should never be handled live if there is any chance of the sample 

being involved with a quarantine breach. For the purposes of this protocol, all fruit fly samples, where 

the fruit fly adult, larva or egg has been removed from its substrate, should be placed in a sealed vial 

or container and either frozen (at -20 o C) or stored in 100% ethanol. The sample vial should have 

labels stating the collection details including (at a minimum) the collector, collection date, host if 

known, place of collection and accession number(s). 

Samples should be collected and despatched in a manner compliant with PLANTPLAN (with particular 

reference to sampling procedures and protocols for confirmation). 

13

6 Identification 

6.1 Overview 

The National Handbook for the Identification of Fruit Flies in Australia (overview presented in Figure 3 

and Figure 4) proposes that primary identification is undertaken using conventional taxonomy with the 

support of molecular genetic techniques for some species. The diagnostic methods available for each 

species are presented in Table 2 and covered in greater detail in sections 6.2. (Morphological), 6.3.1. 

(PCR amplification), 6.3.2 (DNA barcoding) and 6.4 (Allozyme Electrophoresis). These techniques are 

currently in use in Australia and form the basis of this national protocol. Section 7 contains data sheets 

with the specific morphological and molecular diagnostic information for each species. 

Molecular techniques are best used to support or augment morphological identification. They can be 

used to identify early larval stages (which are hard to identify reliably on morphological features) and 

eggs. They can also be used for incomplete adults that may be missing specific anatomical features 

required for morphological keys, or specimens that have not fully developed their features (especially 

colour patterns). It should be recognised, however, that the success of a molecular diagnosis can be 

impacted by factors such as life stage, specimen quality or any delays in processing. As a result, the 

suitability of each method has been identified. 

The molecular protocols require a laboratory to be set up for molecular diagnostics, but can be carried 

out by almost any laboratory so equipped. Access to published sequences is required for whichever 

protocol is being used 1 . 

Most molecular techniques presented in this standard involve the amplification of particular region(s) 

of the fly genome using a polymerase chain reaction (PCR). Often the target is the internal transcribed 

spacer region of the ribosomal RNA operon referred to as ITS1. Many species can be identified by the 

size of the ITS1 alone although similar species often produce fragments of the same size. In this case, 

restriction digestion of the ITS1 PCR product can be performed, using each of up to six different 

restriction enzymes. This approach is referred to as restriction fragment length polymorphisms (RFLP) 

analysis. This does not necessarily eliminate non-economic fruit flies but will identify if the restriction 

pattern produced conforms to that produced by a reference fly from an economically important 

species. If the species is still not identified, more comprehensive information can be obtained by 

undertaking nucleotide sequence analysis. 

DNA barcoding, focusing on analysis of the mitochondrial gene for cytochrome oxidase subunit I (COI) 

is now available as an alternative to ITS-based techniques. This technology sometimes provides more 

accurate and consistent results than analysis of the ITS region, with less confusing overlap between 

taxa; however, inconsistencies and anomalies can still arise, particularly among closely related 

species complexes. 

This national protocol is presented on the premise that ITS analysis and DNA barcoding are used 

alongside morphological methods. Most species can generally be resolved using traditional or 

molecular taxonomy without ambiguity. However, more difficult cases will only yield to a combination 

of both morphological and one or more molecular approaches. 

1 Many of the DNA barcoding sequences were obtained by the CBOL tephritid fruit fly project 

(www.dnabarcodes.org/pa/ge/boli_projects), which examined all economically important tephritid fruit fly species known to be 

agricultural pests as well as many closely related species. 

14

Figure 3. Overview of fruit fly diagnostic procedures (adult specimens) 

Start 

RESOURCES 

Targeted species list 

Microscope procedures 

Reassessment by 

“in house” second 

entomologist 

Confident of 

diagnosis? 

No 

Separation of material 

for molecular genetic 

testing 

Referral to 

network 

laboratory 

Confident of 

diagnosis? 

No 

Referral to a 

national 

authority 

RESOURCES 

Victoria, NSW and SA 

protocols 

Fruit fly sample 

receipt 

Yes 

Yes 

Inspection of material, 

quality check and sample 

preparation 

MORPHOLOGICAL 

IDENTIFICATION 

See Table 2 

No Confident of 

diagnosis? 

Yes 

GENETIC 

DETERMINATION 

(PCR-RFLP) 

See Table 2 

PCR-DNA 

BARCODING 

See Table 2 

Option 

ALLOZYME 

ELECTROPHORESIS 

See Table 2 

Allocation of samples 

to staff according to 

experience 

REFERENCES 

National protocol and 

reference specimens, 

see also Section 8 for 

further references 

Notification as 

required 

Report as: 

• Target species 

• Endemic 

• Exotic 

• Seeded 

Pinned as part 

of regional 

and/or national 

collection 

Databased 

Specimen 

of value? 

Yes No 

Specimen 

disposed of 

15

Figure 4. Overview of fruit fly diagnostic procedures (larval specimens) 

Start 

Receipt of 

fruit fly 

larvae 

RESOURCES 

Targeted species list 

Microscope procedures 

Reassessment by “in 

house” second 

entomologist 

Confident of 

diagnosis? 

No 

Separation of material for 

molecular genetic testing 

Referral to network 

laboratory 

Confident of 

diagnosis? 

No 

Referral to a 

national authority 

RESOURCES 

Victoria, NSW and SA 

protocols 

Yes 

Yes 

Inspection of 

material, quality 

check 

Allocation of samples to 

staff according to 

experience 

MORPHOLOGICAL 

IDENTIFICATION 

See Table 2 

No 

Confident of 

diagnosis? 

Yes 

GENETIC 

DETERMINATION 

(PCR-RFLP) 

See Table 2 

PCR-DNA 

BARCODING 

See Table 2 

Option 

ALLOZYME 

ELECTROPHORESIS 

See Table 2 

REFERENCES 

National protocol, see 

also Section 8 for further 

references 

Notification as 

required 

Report as: 

• Target species 

• Endemic 

• Exotic 

• Seeded 

Alcohol preserved as 

part of regional and/or 

national collection 

Preparation of larvae for 

morphological 

examination 

Databased 

Specimen of 

value? 

Yes No 

Specimen 

disposed of 

16

Table 2. Diagnostic methods used to identify fruit fly species 

Scientific name Morphological 

description (6.2) 

PCR-RFLP 

(6.3.1) 

Anastrepha fraterculus (14) 

Anastrepha ludens (10) 

Anastrepha obliqua (16) 

Anastrepha serpentina (13) 

Anastrepha striata (14) 

Anastrepha suspensa (7) 

Bactrocera albistrigata (1) 

Bactrocera aquilonis 1 1 (36) 

Bactrocera atrisetosa (0) 5 

Bactrocera bryoniae (10) 

Bactrocera carambolae (10) 

Bactrocera caryeae (1) 

Bactrocera correcta (15) 

Bactrocera cucumis (8) 

Bactrocera cucurbitae (72) 

Bactrocera curvipennis (2) 

Bactrocera decipiens (0) 5 

Bactrocera dorsalis 2 2 (29) 

Bactrocera facialis (1) 

Bactrocera frauenfeldi (16) 

PCR-DNA 

Barcoding 4 (6.3.2) 

Bactrocera jarvisi (6) 

Bactrocera kandiensis (10) 

Bactrocera kirki (5) 

Bactrocera latifrons (20) 

Bactrocera melanotus (3) 

Bactrocera musae 3 (5) 

Bactrocera neohumeralis 1 1 (4) 

Bactrocera occipitalis (5) 

Bactrocera papayae (11) 

Bactrocera passiflorae (1) 

Bactrocera philippinensis 2 2 (9) 

Bactrocera psidii (2) 

Bactrocera tau (5) 

Bactrocera trilineola (2) 

Allozyme 

Electrophoresis 

(6.4) 

17

Scientific name Morphological 

description (6.2) 

PCR-RFLP 

(6.3.1) 

Bactrocera trivialis (3) 

PCR-DNA 

Barcoding 4 (6.3.2) 

Bactrocera tryoni 1 1 (12) 

Bactrocera umbrosa (9) 

Bactrocera xanthodes (7) 

Bactrocera zonata (22) 

Ceratitis capitata (120) 

Ceratitis rosa (24) 

Dirioxa pornia (3) 

Rhagoletis completa (0) 5 

Rhagoletis fausta (1) 

Rhagoletis indifferens (0) 5 

1 Species cannot be distinguished from each other at the ITS or COI region 

2 Species cannot be distinguished from each other at the ITS or COI region 

3 Requires full ITS sequencing to split B. musae from the B. philippinensis, B. dorsalis group 

Allozyme 

Electrophoresis 

(6.4) 

4 Numbers in brackets refer to the number of individuals of that species with (COI) DNA barcodes of >500 bp on 

the Barcode of Life website (www.boldsystems.org/views/taxbrowser.php?taxid=439; as of 23 August 

2011). 

5 DNA barcodes (COI) are available for other species in these genera. There are 86 species of Bactrocera, 65 

species of Dacus, and 19 species of Rhagoletis that do have barcodes available (as of 23 August 2011). 

6.2 Morphological identification 

Approximately 90% of the dacine pest species can be identified accurately, and quickly, by 

microscopic examination of the adult. For these species there is no need for supporting evidence. The 

remaining 10% (mainly some dorsalis complex species) can be identified with this same method but 

require expert examination and may require additional supporting evidence such as the molecular 

diagnosis or host association records. 

Only morphological diagnostic procedures and information for adult fruit flies are contained in this 

document. Aside from molecular techniques, larval diagnosis has been excluded from this protocol. 

6.2.1 Procedure 

The following apparatus and procedures should be used to prepare the specimen for identification 

(adapted from QDPIF 2002): 

Apparatus: 

• Stereoscopic microscope or Stereomicroscope with magnification range of 7X to 35X. 

• Light source 

• 90mm diameter petri dishes 

• Forceps (Inox #4) 

18

Preparation procedure: 

1) Ensure the workstation is clean and clear of all flies before commencing. 

2) Adjust chair height and microscope, and turn on the light source (refer to specific operating 

procedures for the microscope in use). 

3) If applicable, record the lure and trap type or host material in which the specimen was found. 

4) Carefully place the fruit fly into a plastic petri dish. If examining more than one fly at once 

ensure there is a single layer of flies only, with room to move flies from one side of the dish 

to the other. 

5) While looking through the microscope check each fly individually. Manipulate them with the 

forceps so that diagnostic features are visible. 

6.2.2 Identification 

Key features (Figure 5, Figure 6, Figure 7 and Figure 8) used for the morphological diagnosis of adult 

fruit flies include: 

• Wing morphology and infuscation 

• Presence or absence of various setae, and relative setal size. (Note: Chaetotaxy, the practice 

of setal taxonomy, is not as important in this group as some others.) 

• Overall colour and colour patterning 

• Presence, shape and colour of thoracic vittae. A vitta is a band or stripe of colour. 

Use the morphological diagnostic key and descriptions contained in Section 7 to identify the species of 

fruit fly under microscopic examination. 

If identification cannot be made using this diagnostic procedure and/or the specimen is suspected to 

be of quarantine concern, it should be referred to either a State or National authority (see section 8.1 

Key contacts and facilities). If the specimen is identified as an exotic fruit fly, it should be referred to a 

National Authority within 24 hours and the appropriate National Authority notified as required in 

PLANTPLAN. 

19

Figure 5. Adult morphology; head (top) and wing (bottom) (White and Elson-Harris 1992). 

ar – arista 

comp eye – compound eye 

fc – face 

flgm 1 – 1 st flagellomere 

fr – frons 

fr s – frontal setae 

gn – gena (plural: genae) 

gn grv – genal groove 

g ns – genal seta 

i vt s – inner vertical seta 

lun – lunule 

oc – ocellus 

oc s – ocellar seta 

o vt s – outer vertical seta 

orb s – orbital setae 

pafc – arafacial area 

ped – pedicel 

poc s – postocellar seta 

pocl s – postcular setae 

ptil fis – ptilinal fissure 

scp – scape 

vrt – vertex 

20

Figure 6. Adult morphology, Thorax; Dorsal features (White and Elson-Harris 1992). 

a npl s – anterior notopleural seta 

a sctl s – apical scutellar seta 

a spal s – anterior supra-alar seta 

a spr – anterior spiracle 

anatg – anatergite 

anepm – anepimeron 

anepst – anepisternum 

anepst s – upper anepisternal 

seta 

b sctl s – basal scutellar seta 

cx – coax 

dc s – dorsocentral seta 

hlt – halter or haltere 

ial s – intra-alar seta 

kepst – katepisternum 

kepst s – katepisternal seta 

ktg – katatergite 

npl – notopleuron 

p npl s – posterior notopleural 

seta 

p spal s – posterior supra-alar 

seta 

p spr – posterior spiracle 

pprn lb – postpronotal lobe 

pprn s – postporontal seta 

prepst – propisternum 

presut area – presutural area 

presut spal s – preutural supraalar 

seta 

psctl acr s – prescutellar 

acrostichal seta 

psut sct – postcutural scutum 

sbsctl – subscutellum 

scape – scapula setae 

sctl – scutellum 

trn sut – transverse scuture 

21

Figure 7. Adult morphology, thorax; lateral features (White and Elson-Harris 1992). 

See Figure 5 for abbreviations. 

Figure 8. Adult morphology, abdomen; male with features of typical dacini (left), Female, with extended ovipositor 

(right) (White and Elson-Harris 1992). 

acul – aculeus 

ev ovp sh – eversible ovipositer 

sheath 

ovsc – oviscape 

st – sternites numbered 1-5 in 

the male and 1-6 in the female 

tg – tergites where 1+2 are fused to 

form syntergosternite 1+2, followed by 

tergites 3-5 in the male and 3-6 in the 

female 

22

6.3 PCR – based identification 

6.3.1 Restriction Fragment Length Polymorphism 

Two Restriction Fragment Length Polymorphism (RFLP) tests are described below. In both tests, the 

internal transcribed spacer region (ITS1), part of the nuclear rRNA gene cluster, is amplified through 

Polymerase Chain Reaction (PCR) methods and then digested with various enzymes. Test 1 was 

developed by McKenzie et al. (2004). In this test a DNA fragment (600 to 1200 bp in length) is 

amplified and can be used for identification of at least 30 fruit fly species. Methods used in Test 2 are 

similar to Test 1 but the former amplifies a slightly larger (1.5-1.8 kb) DNA fragment, encompassing 

the 18S and the ITS1 genes (see figure below). Test 2 was originally developed by Armstrong and 

Cameron (1998) and included at least 31 economically significant fruit fly species. This test has been 

adopted and slightly modified by Linda Semeraro and Mali Malipatil, Victorian Department of Primary 

Industries (Semeraro and Malipatil 2005) to specifically identify only a few main fruit fly groups of 

interest (see Target below). 

Figure 9. Part of the ribosomal RNA operon with the location of primer positions for Tests 1 and 2 

AIM 

NS15 

These tests aim to use a prescribed molecular protocol to identify DNA from targeted fruit fly species. 

TARGETS 

Despite there being many hundreds of species of fruit flies in the Australasian region Test 1 targets 30 

species (Table 2) that have been assessed as being of the highest economic importance to Australia. 

The assessment of targets includes factors such as host range, frequency of interaction (trade, 

migration etc.) and prior incursions. This priority listing was assembled in consultation with fruit fly 

workers and quarantine authorities. Test 2 is used for the diagnosis of the Bactrocera tryoni group 

(including B. tryoni, B. neohumeralis and B. aquilonis) and Ceratitis capitata only. 

SUITABILITY 

18S ITS1 5.8S ITS2 28S 

baITS1f baITS1r 

Test 1 

Test 2 

Good/suitable for fresh adults, fresh larvae or fresh eggs but viability of this method requires 

specimens of adequate freshness so prior sample handling, storage and preparation very influential 

on diagnostic outcome. 

Use of these tests cannot necessarily eliminate from the identification fruit flies of other less 

economically important species not included as targets. Host records (Section 7) for the target taxa 

may assist in the elimination of possible non target species. Fruit fly adults or larvae producing nonconforming 

restriction patterns can be assumed not to belong to the economically important species 

included in this key. 

ITS6 

23

The amount of DNA extracted varies between adults and larvae but we have used these methods to 

analyse mature larvae (2nd & 3rd instars). The protocol should also work for small fruit fly larvae (1st 

and 2nd instar) and eggs if the extraction process is scaled down. This protocol is as effective for 

larvae as for adult flies. 

RFLP TEST 1 

6.3.1.1.1 Procedure overview 

DNA is extracted from fruit flies (adults or larvae) using a commercially available kit. A region of the fly 

genome (an internal transcribed spacer region of the ribosomal RNA operon, referred to as ITS1) is 

amplified using the PCR. Some species can be identified based on the length of this fragment. 

Otherwise the ITS1 fragment is digested using each of up to six different restriction enzymes using a 

process known as analysis of Restriction Fragment Length Polymorphisms (or RFLP) 2 . 

6.3.1.1.2 Sample handling 

Samples should be collected and despatched in a manner compliant with PLANTPLAN (with particular 

reference to sampling procedures and protocols for confirmation). 

Fruit fly adults, larvae and eggs should never be handled live if there is any chance of the sample 

being involved with a quarantine breach. For the purposes of this protocol all fruit fly samples, where 

the fruit fly adult, larva or egg has been removed from its substrate should be placed in a sealed vial or 

container and either frozen (at -20 o C) or stored in 100% ethanol. The sample vial should have labels 

stating the collection details including (at minimum) the collector, collection date, host if known, place 

of collection and accession number(s). 

2 It is not clear that this method will reliably discriminate between B. tryoni and B. aquilonis, particularly if relying on agarose gel 

separation/detection as described in the protocol. The method relies on “specimens of utmost freshness so prior sample 

handling, storage and preparation are very influential on diagnostic outcome”. The protocol states that if there is a size match for 

an unknown “it could be either a pest or non-pest species”. There is an overlap in the size of the PCR product for B. tryoni and 

B. aquilonis (810-830 bp vs. 790-830 bp). Even with additional enzyme cleavage, which can sometimes discriminate PCR 

products of similar size, there is only one enzyme in the protocol that produces a difference between these two species 

(Sau3aI), and that results in a 5 bp difference, which would not be discriminated by standard gel electrophoresis. In the event of 

follow-up DNA sequencing, there is still no guarantee that the identity of fruit fly would be confirmed as “…differences in DNA 

sequence ….in many species frequently presents problems with this approach”. It is not clear in the protocol whether these two 

species were DNA sequenced, or whether they proved problematic. This could be explored further. As stated in the protocol, the 

molecular results are “designed to support morphological identification”, and it’s also suggested that they be taken in the context 

of differences in geographical distribution and hosts. NB: Reference fragment lengths for each species are contained in the 

relevant data sheets in Section 7. 

24

Figure 10: Workflow of molecular procedures for fruit fly identification 

No 

1. Choose standards to 

run in conjunction with 

unknown 

2. Prepare specimens 

3. DNA extraction from 

fruit fly sample 

4. PCR amplification 

5. Test for amplified DNA 

6. Has DNA been 

amplified? 

Yes 

7. Assess ITS1 fragment 

length 

Start 

12. Assess fragment 

number and length 

8. Has FF been 

uniquely 

identified? 

No 

13. Document fruit fly 

identification 

End 

11. Run appropriate 

enzymes 

10. Select new criteria 

Yes 

9. Are any valid 

criteria left? 

Yes No 

25

6.3.1.1.3 Extraction of DNA from fruit fly material 

Equipment 

• Pipettors and tips 

• Sterile disposable microcentrifuge tubes 

• Microcentrifuge 

• Gel tank and power pack 

• Latex or Nitrile gloves 

• Microwave 

• UV transilluminator with camera 

Reagents 

Method 

• DNeasy Tissue QIAGEN Kit (but other similar kits could be tried) 

• 1 x PBS 

• Ethanol (Reagent grade) 

• Agarose (Amresco) 

• 1 x TBE 

• DNA molecular weight marker (aka 100 bp ladder) 

• Ethidium bromide (Sigma), staining solution at 800 ng µL -1 final concentration 

Extraction is essentially as per manufacturer’s recommendations. 

1) Use aseptic technique to place

16) Check DNA quality on a 1% agarose gel made up in 1X TBE. Load 1-5 µL DNA solution + 

2 µL Gel Loading Buffer in each well, and run at 80 V x 60 min or 120 V x 30 min. Post-stain in 

a 1 mg L -1 ethidium bromide solution. 

6.3.1.1.4 Amplification of ITS1 region from fruit fly material using the polymerase chain 

reaction 

Equipment 





• Latex or Nitrile gloves 

• Microwave 


• Thermocycler 

• Personal protective equipment including lab coat, eye protection, gloves 

Reagents 

Method 

• Primer sequences are: 

baITS1f 5’ GGA AGG ATC ATT ATT GTG TTC C 3’ (McKenzie et al. 1999) 

baITS1r 5’ ATG AGC CGA GTG ATC CAC C 3’ (McKenzie et al. 1999) 

• 1X TBE buffer 

• 1% (w/v) agarose gel: 1 g DNA grade agarose per 100 mL 1X TBE 

• 6X Loading dye 

• DNA molecular weight marker (aka 100 bp ladder) 

• Ethidium bromide staining solution (final concentration 800 ng µL -1 ) 

In pre-PCR cabinet: 

1) Label sterile 0.2 mL PCR tubes. 

Manufacturer’s reaction buffer 

(10X) 

Final concentration Each 

1X 5 µL 

MgCl2 (50 mM) 1.5 mM 1.5 µL 

dNTP’s (2 mM) 200 µM 5 µL 

Forward primer (10 µM) 1 µM 5 µL 

Reverse primer (10 µM) 1 µM 5 µL 

H2O 20.25 µL 

Taq polymerase enzyme (5U µL -1 ) 0.25 µL 

Total volume 42 µL 

27

In BSC: 

2) Store “Master Mix” on ice in sterile 1.5 mL centrifuge tube. 

3) Add 8 µL of sterile dH2O to the first negative control tube. 

1) Add the Taq polymerase to the Master Mix in the BSC. 

2) Aliquot 42 µL Master Mix to the each PCR tube. 

3) Add 8 µL of DNA extract to each sample tube as appropriate. 

4) Add 8 µL of positive control DNA appropriate tube(s). 

5) Add 8 µL of sterile dH2O to the second negative control tube. 

6) Cycle the tubes using the following program: 

Cycle 1 Step 1 94 o C 2 min 

Cycles 2 to 35 Denaturing 94 o C 1 min 

Annealing 60 o C 1 min 

Extension 72 o C 1 min 

Final extension 72 o C 

5 min 

7) Place reaction products on ice or freeze until ready to analyse. 

8) Mix 3 µL of each PCR sample with 2 µL loading dye. 

9) Load samples and 100 bp DNA ladder onto separate wells of 1% (w/v) agarose gel in 1X TBE. 

10) Electrophorese in 1X TBE buffer at 100 V for around 40 min. 

11) Stain the gel in ethidium bromide, according to local Standard Operation Procedure. 

12) Visualise bands and capture image using the Gel Documentation System. 

Analysis of ITS fragment length 

The expected size of the amplified product is between 600 and 1200 bp, depending on the species. 

Some species can be differentiated from others on the target list simply by the size of their ITS1 

fragment, particularly if combined with other data on host or geographic origin (Section 7). 

Sizes of ITS1 fragments for the species in the target list are shown in Table 3. Sizes are given as a 

range to reflect that sizing is approximate when using low-resolution gel electrophoresis systems such 

as these. 

28

Table 3. Approximate size in bp of the ITS1 region for each species 

Species Fragment range Species Fragment range 

A. ludens 640-680 B. latifrons 760-780 

A. obliqua 650-690 B. moluccensis 800-820 

A. serpentina 740-760 B. musae 770-790 

B. albistrigata 840-860 B. neohumeralis 810-840 

B. aquilonis 790-830 B. papayae 800-840 

B. bryoniae 790-830 B. passiflorae 810-840 

B. carambolae 830-860 B. philippinensis 800-840 

B. cucumis 760-770 B. psidii 780-800 

B. cucurbitae 590-610 B. tryoni 810-830 

B. curvipennis 830-860 B. umbrosa 750-780 

B. dorsalis 800-820 B. xanthodes 670-700 

B. endiandrae 770-800 B. zonata 820-850 

B. facialis 750-780 C. capitata 890-900 

B. frauenfeldi 830-860 C. rosa 1000-1040 

B. jarvisi 800-840 R. pomonella 740-780 

B. kirki 840-860 D. pornia 500-520 

6.3.1.1.5 Restriction digestion of PCR product 

If the species of fly is not identified by the size of the ITS1 fragment, a restriction digest on the ITS1 

PCR product is performed to differentiate between species. These data are self-contained, and the 

table could be used as the only tool to identify an unknown fly. Flies producing fragments of less than 

700 bp or greater than 900 bp are segregated and then restriction enzymes are used in series to 

differentiate the species. 

Enzymes were also selected based on the requirement for differences in fragment sizes to be easily 

detected by visual examination of an agarose gel. 

The scheme developed, particularly the use of a combination of enzymes in series, allows definitive 

identification of the majority of the species. This powerful combination eliminates the reliance on 

discrete restriction sites and limits the likelihood of false negatives that may arise through a rare 

recombination event. 

Restriction endonucleases used are VspI, HhaI, SspI, HinfI, BsrI, SnaBI and Sau3aI. During the 

development of this standard enzymes purchased from New England Biolabs were used but other 

brands would work equally well. 

Since the time this protocol was developed, nucleotide sequencing has also become much more 

routine and affordable and this type of analysis may be more applicable to laboratories with this 

capacity. 

29

Equipment 




• Dry heating block, waterbath or similar 


• Latex or nitrile gloves 

• Microwave 

• UV transilluminator with camera and image capture and analysis software 


Reagents 

Method 

• Sterile distilled water 

• Bovine serum albumin (BSA, 10 μg μL -1 ) (comes supplied with NEB enzymes) 

• Restriction enzymes VspI, HhaI, SspI, HinfI, BsrI, SnaBI, and Sau3aI 

• Restriction buffer supplied with enzyme 

• Ethidium bromide solution, 800 ng μL -1 final concentration 

1) Label microcentrifuge tubes. 

2) To each centrifuge tube add: 

Water 2.3 μL 

10X buffer 2 μL 

BSA (10 ug µL -1 ) 

0.2 μL 

PCR product 5 μL 

Restriction enzyme 0.5 μL 

3) Mix reagents and place tubes in a waterbath preheated to 37 o C for 2 h. 

4) Store tubes on ice or at -20 o C until ready to load on agarose gel. 

5) Add 3 µL of 6X loading buffer to each tube. 

6) Load the entire volume of each sample (23 μL) into a lane of a 2% (w/v) high resolution blend 

agarose gel. 

7) Load 100 bp DNA molecular weight marker into one or two wells of the gel. 

8) Analyse products by electrophoresis at 100 V for 50 min. 

9) Stain the gel with ethidium bromide. 

10) Visualise fragments using a UV transilluminator. 

11) Capture gel image using gel documentation system. 

30

Analysis of RFLP products 

In analysis of RFLP profiles for diagnostic purposes, bands under 100 bp and over 1500 bp in size are 

disregarded. The molecular weights of experimental bands are calculated with reference to the DNA 

molecular weight standards loaded on the same gel. 

Table 4 summarises the data for the ITS1 fragment length and the six restriction enzymes used within 

this diagnostic procedure. 

6.3.1.1.6 Nucleotide sequencing analysis of entire ITS1 fragment 

The PCR product can also be sequenced to confirm the identity of fruit fly if required, however a 

region near one end that is AT-rich in many species frequently presents problems with this approach. 

Nucleotide sequencing can be done in-house or outsourced; details of the reaction chemistry and 

fragment resolution are not presented here. 

Equipment 







• PC with internet access 

• Software programs for analysis 

Reagents 

• Primers: 

baITS1f 5’ GGA AGG ATC ATT ATT GTG TTC C 3’ (McKenzie et al. 1999) 

baITS1r 5’ ATG AGC CGA GTG ATC CAC C 3’ (McKenzie et al. 1999) 


• 1% (w/v) Agarose gel 

• Loading dye 

• Molecular mass DNA ladder (Invitrogen) 

• Ethidium bromide staining solution (final concentration 800 ng mL -1 ) 

• JetQuick PCR Purification Kit (Astral Scientific) 

• Nucleotide sequencing kit 

31

Table 4. Analysis of RFLP products from ITS1 fragments from fruit flies 

Species 

ITS1* HinfI VspI HhaI SspI BsrI SnaBI Sau3aI 

900 DNC Cuts DNC Cuts DNC Cuts DNC Cuts DNC Cuts DNC Cuts DNC Cuts 

A. ludens X 550 550 X X X X X 

A. obliqua X 450, 270 550 X 550, 150 X X 450, 200 

A. serpentina X X 420, 250 X X X X 530, 200 

B. albistrigata X X X 670, 180 620, 180 X X 450, 400 

B. aquilonis X 770 X 640, 190 570, 180 600, 200 X 415 

B. bryoniae X 760 X 620, 200 560, 180 600, 230 X 400 

B. carambolae X X 480, 350 680, 200 X 650, 250 530, 350 450, 400 

B. cucumis X X X 550, 180 X X X X 

B. cucurbitae X X X 400, 180 X X X X 

B. curvipennis X X X 620, 170 550, 200 570, 250 X 420 

B. dorsalis X 770 X 650, 190 X 650, 260 540, 320 X 

B. facialis X X X 600, 180 X 600, 200 X 390 

B. frauenfeldi X X X 620, 180 X X 450, 400 

B. jarvisi X 770 X 640, 180 700 600, 250 X 420 

B. kirki X X X 680, 190 620, 180 X X 450, 400 

B. latifrons X X X 600, 190 X 600, 200 X X 

B. musae X X X 635, 220 X 600, 250 520, 320 X 

B. neohumeralis X 770 X 640, 190 570, 180 600, 200 X 420 

B. papaya X 770 X 650, 190 750 650, 260 535, 320 X 

B. passiflorae X 770 X 650, 190 750 650, 270 X X 

B. philippinensis X 770 X 650, 190 750 630, 250 535, 320 X 

B. psidii X X X 640, 190 570, 250 X X X 

B. tryoni X 770 X 640, 190 570, 180 600, 200 X 420 

B. umbrosa X 730 X 600, 190 680 X X 380 

B. xanthodes X 680 X 670, 200 380, 250 X X X 

B. zonata X X X 680, 190 750 600, 200 535, 330 X 

C. capitata X X 650, 200 X 520, 160 X X X 

C. rosa X 800, 200 600, 300 X 570, 480 X X X 

Di. pornia X X X X 300, 220 X X X 

* The length of the ITS1 fragment and the response of each to seven restriction enzymes (HinfI, VspI, HhaI, SspI, BsrI, SnaBI, Sau3aI) are indicated for each of the target 

species. ITS1 fragment length is scored as one of three classes (approximate length in bp). Enzyme responses are measured in two classes - either does not cut (DNC) or cuts 

(Cuts – this column shows the length of each fragment in bp). 

32

Method 

1) Amplify the ITS1 region as per section 6.3.1.1.4 (Amplification of ITS1 region from fruit fly 

material using the polymerase chain reaction). 

2) Clean the amplified DNA away from other reaction components using JetQuick Spin kit as 

per manufacturer’s instructions (or other similar process). 

3) Load a fraction of the cleaned DNA onto an agarose gel against DNA mass standards to 

quantitate the concentration of DNA in the cleaned PCR product (ng μL -1 ). 

4) Prepare cleaned PCR products for sequencing as per the manufacturer’s instructions. 

5) Perform nucleotide sequencing reaction and resolve products. 

6) Consolidate forward and reverse reactions for each fragment to determine fragment 

sequence. 

7) Compare fragment sequences against all sequences posted on the GenBank database 

(www.ncbi.nlm.nih.gov/genbank) using the program BlastN (Altschul et al. 1997), to 

determine if the sequence is Tephritidae and which species. 

6.3.1.1.7 Composition of reagents 

5X TBE buffer 

• 450 mM Tris base 

• 450 mM Boric acid 

• 10 mM EDTA (pH 8.0) 

• Store at room temperature 

Dilute to 1X TBE with millipore water prior to use. 

1% Agarose gel 

1) 1 g of DNA grade agarose per 100 mL of 1X TBE. 

2) Melt in a microwave. 

3) Pour into a prepared gel tray when agarose has cooled sufficiently. 

4) Allow the gel to set at room temperature for at least 30 min before use. 

6 x Loading dye 


• 0.25% (w/v) Bromophenol Blue 

• 0.25% (w/v) Xylene cyanol FF 

• 30 % (v/v) Glycerol 

Store at room temperature. 

10X PBS 

• 1.37 M NaCl 

• 27 mM KCl 

• 43 mM Na2HPO4.7H2O 

• 14 mM KH2PO4 

33

1) Autoclave. 

2) Store at room temperature. 

3) Dilute to 1X PBS with sterile water for use. 

4) Store 1X PBS buffer at room temperature in sterile bottle. 

RFLP TEST 2 

6.3.1.1.8 Procedure overview 

As in Test 1, fruit fly DNA is extracted using a commercially available kit. The nuclear internal 

transcribed spacer (ITS1) and partial 18S genes are amplified using PCR techniques. The PCR 

product is then digested using four recommended restriction enzymes and the fragments of different 

sizes are visualised on a gel. Digested fragment patterns are then compared to those of B. tryoni and 

C. capitata. 

NB: Reference fragment lengths for each species are contained in the relevant data sheets in 

Section 7 and gel image provided in Section 6.3.1.1.12 below. 

6.3.1.1.9 Sample handling 

Refer to details in Test 1. Live larvae can be placed directly into boiling water for fixing. Larvae are 

then placed into 100% ethanol and if not used immediately for extraction are stored in -20 o C or -80 o C. 

Adults may be stored dry or in 100% ethanol but preferably stored at -20 o C freezer. 

34

Figure 11: Workflow of molecular diagnostic procedure for fruit fly identification 

Receive samples of presumed fruit fly 

larvae for identification 

Morphological examination conducted to ascertain whether specimens are fruit 

flies – 

1. If YES, determine whether QFF. 

2. If identification to species is not possible (based on morphology), then 

proceed further 

Molecular diagnostic 

Test (PCR-RFLP) 

DNA Extraction 

(QIAGEN DNeasy ® 

Blood and Tissue Kit) 

PCR amplification 

(ITS1 + 18S) 

(include QFF +ve ctrl) 

PCR product 

positive = band at 

~1500 bp 

Restriction Fragment 

Length Polymorphism (RFLP) 

(digest PCR product using four enzymes- AluI, DdeI, RsaI and SspI) 

Gel Analysis – compare size of 

fragment/s with restriction 

profile for QFF group and 

MedFly 

Specimen profile = 

QFF/MedFly or not. 

Species diagnosis 

completed 

35

6.3.1.1.10 Extraction of DNA from fruit fly material 

Materials and Equipment 

• blotting paper (or kimwipes) 

• blades 

• Eppendorf tubes (1.5 mL) and racks 

• ethanol (100%) 

• heating block 

• ice 

• forceps 

• plastic pestles (0.5 mL) 

• pipettes (0.02-2 µL, 2-20 µL, 20-200 µL, 200-1000 µL) 

• pipette tips – aerosol resistant 

Preparation of specimens for extraction 

Larvae 

i. Blot specimens on towel paper and leave to dry for at least 1 min until ethanol evaporates. 

ii. Cut mid-section of larva (use middle 1/3 of specimen) and place in a 1.5 mL Eppendorf tube 

(use equal quantity of material for each sample if possible). 

iii. Place head (anterior 1/3, with spiracles and mouth-hooks) and posterior part of abdomen 

(posterior 1/3, with spiracles and anal lobes) into a separate 1.5 mL Eppendorf tube in 100% 

ethanol to be stored at -20 o C for future reference. 

iv. Keep specimens on ice until ready for grinding. 

Adults 

i. Blot specimens if stored in ethanol. 

ii. Remove head or legs for extraction. 

iii. Pin/ dry mount remaining specimen or place back into ethanol (with cross-referenced labels) 

for future reference. 

iv. Centrifuge Eppendorf tube (with dissected insect section). 

Note: 

i. Allow approximately 1-3 h for processing 1-10 specimens. 

ii. Before starting heat water bath or heating block to 55 o C. 

QIAGEN Kit extraction 

Refer also to instructions in QIAGEN DNeasy ® Blood and Tissue kit handbook for guide to animal 

tissue extractions but note any differences in instructions below indicated by an asterisk. 

v. Add 5 µL of Buffer ATL and 5 µL of Proteinase K to sample. Grind specimen using 0.5 mL 

plastic pestle until there are no large fragments visible. 

vi. Add 195 µL of Buffer ATL and 15 µL of Proteinase K and vortex for 5 s. Incubate for 1-1 ½ h 

at 55°C. 

36

vii. Vortex for 15 s. Then add 200 µL of Buffer AL. Vortex and incubate for 10 min. 

viii. Add 200 µL of ethanol and vortex again for 5 s. 

ix. Pipet mixture into QIAGEN column and centrifuge at ~6000 g for 1 min. Discard flow-through. 

x. Place column into a new collection tube. Add 500 µL of Buffer AW1. Centrifuge at ~6000 g for 

1 min and discard flow-through. 

xi. Place column into a new collection tube. Add 500 µL of Buffer AW2. Centrifuge at ~20, 000 g 

and centrifuge for 3 min. Discard flow-through. 

xii. Place column into a new 1.5 mL tube and add AE buffer. *If part specimen (such as 1/3 of the 

larva, or the adult fly head, or legs of adults), use only half of the elution buffer recommended 

in the DNeasy® Blood and Tissue Handbook (for Spin Column protocol) (i.e. only use 100 µL 

or less for each elution step. 

xiii. Incubate at room temperature for 1 min and then centrifuge for 1 min at 6000 g. 

6.3.1.1.11 Amplification of ITS1 and 18S gene region from fruit fly material using the 

polymerase chain reaction 

Note: A single PCR product should be between 1.5 – 1.8 kb in size 

Materials and equipment 

• centrifuge 

• Eppendorf tubes (0.5 mL and 0.2 mL) 

• ice 

• PCR machine 

• pipettes (various sizes incl. 2.0-20 µL, 20-200 µL, 200-1000 µL) 

• pipette tips – aerosol resistant 

• plastic storage racks 

• vortex 

Chemicals and reagents 

• dNTPs (2.5 μM) 

• nuclease free H2O 

• primers 

o (10 μM) - NS15 5’ CAATTGGGTGTAGCTACTAC 3’ 

o (10 μM) - ITS6 5’ AGCCGAGTGATCCACCGCT 3’ 

• NEB Taq polymerase or (5U µl -1 ) 

• NEB Thermpol buffer (X10) 

37

Master mix recipe Final Concentration Per reaction (μL) 

dd H2O 30.6 

10X Thermpolbuffer 1 X 5 

2.5 μM dNTP's 200 µM 4 

10 μM (ITS6) 0.5 µM 2.5 

10 μM (NS16) 0.5 µM 2.5 

2 Units NEB Taq Polymerase 2 Units 0.4 

Template DNA 5 

Total 50 

Amplification 

1. Vortex extractions for 5-8 s. 

2. Aliquot 5 µL of DNA template to a 0.2 mL tube. Note: Include at least one positive control 

(QFF or Medfly) and one negative control in the test. 

3. Prepare Master Mix using recipe above. 

4. Aliquot 45 μL of master mix to each 0.2 mL tubes (containing 5 µL of template DNA). 

5. Mix product and reagents well (or vortex) and centrifuge for 3-5 s. 

6. Place samples in PCR machine and program the following temperature profile (based on 

Armstrong and Cameron 1998): 

Step 1 

94 o C / 2 min } x1 cycle 

Step 2 

94 o C / 15 s 

60 o C / 30 s } x40 cycles 

68 o C / 2 min 

Step 3 

72 o C / 5 min } x1 cycle 

23 o C / ∞ 

Check product yield after PCR by visualising PCR products on a 1.5% agarose gel and add 1 μL of 

loading dye to 5 μL of PCR product. Use a 100 bp ladder for measuring product size. Run gel at 100 V 

(see instructions in Section 6.3.1.1.15 for preparing and setting up a gel). If product visible at 1.5-1.8 

kb then proceed to Section 6.3.1.1.12 – restriction digest. 

38

6.3.1.1.12 Restriction digestion of PCR product 

Materials and equipment 

• Eppendorf tubes (0.2 mL) 

• ice 

• pipettes (various sizes including 2.0-20 µL, 20-200 µL, 200-1000 µL) 

• pipette tips – Aerosol resistant 

• incubator 

• centrifuge 

• vortex 

Chemicals and Reagents 

AluI, DdeI and RsaI (10 U/µl) and SspI (5U/µl) 

nuclease free H2O 

100X BSA 

10X Buffer 

Restriction enzymes Incubation Temperature Time 

AluI 37°C 2-3 h 

DdeI 37°C 2-3 h 

RsaI 37°C 2-3 h 

SspI 37°C 2-3 h 

Master mix recipe for restriction enzymes (based on recommendations by Melissa Carew, CESAR, 

Melbourne University) 

μL per reaction 

dd H2O 7.2 

10X Buffer 2 

100X BSA 0.2 

Enzyme 0.6 

PCR product 10 

Total 20 

Restriction Digest method 

i. Digest each sample with each of the four enzymes. 

ii. For each samples aliquot 10 μL of PCR product into a 0.2 μL tube (repeat for four tubes in 

total). 

iii. Prepare master mix (following recipe above) for each enzyme. 

iv. Aliquot 10 μL of each Master mix solution to 10 μL PCR product. 

v. Mix reagents and PCR product and centrifuge briefly for 3-5 s. 

vi. Place samples in incubator at temperature recommended for each enzyme. 

39

vii. Prepare a 2-3% agarose gel (see Section 6.3.1.1.15 D) to visualise fragment pattern and use 

a 100 bp ladder for determining fragment sizes 

viii. See Section 6.3.1.1.13 for expected fragment pattern and size of Bactrocera tryoni group and 

Ceratitis capitata. 

Note: Also, compare results with positive controls and check fragment pattern as in Armstrong and 

Cameron (1998). 

6.3.1.1.13 Nucleotide sequencing analysis of entire ITS1 fragment 

Species Pattern Fragment sizes (bp; as in Armstrong and Cameron 1998) 

AluI enzyme 

B. tryoni group C3 780-770, 240-230*, 170, 130 120 110 

C. capitata D3 1300, 130, 120, 110 

DdeI enzyme 

B. tryoni group A5 1000-980*, 270, 220, 170-160 

C. capitata D 1150, 270, 220,130 

RsaI enzyme 

B. tryoni group C1 530-500*, 460-440*, 410, 290 

C. capitata K 450, 380, 290, 260, 240, 210 

SspI enzyme 

B. tryoni group G1 1000, 550, 100 

C. capitata G2 1020, 520, 100 

* = sometimes double band present 

Restriction enzyme pattern types are represented by letters as used in Armstrong and Cameron 

(1998). 

Bactrocera tryoni group (includes 

B. aquilonis, B. neohumeralis and B. tryoni) 

AluI DdeI RsaI SspI 

C3 A5 C1 G1 

Ceratitis capitata D3 D K G2 

Species Distinct enzyme profiles 

Bactrocera tryoni group Unique pattern type for SspI (C. capitata is probably the closest to 

QFF for this enzyme, but look at results for AluI, DdeI and RsaI which 

clearly separates these two groups). 

Ceratitis capitata Unique pattern for DdeI, RsaI and SspI also useful. 

40

Comments: 

1. Variations - for SspI, the smallest fragment (100bp) is not clearly visible on all gels and often 

the Ssp1 enzyme does not fully digest the entire PCR product, thus a full size band (around 

1500 bp) may also appear. 

2. It is a good idea to compare the results with fragment enzyme patterns as presented in 

Armstrong and Cameron (1998). Some patterns may appear very similar amongst species for 

some enzymes but by using at least four enzymes, a unique combination of patterns helps 

distinguish QFF group and Medfly from each other and other species tested. 

6.3.1.1.14 Restriction digest patterns on gel 

Alu1 Dde1 Rsa1 Ssp1 

Bt Bn Cc Bt Bn Cc Bt Bn Cc Bt Bn Cc 

Bt = Bactrocera tryoni (Queensland fruit fly) 

Bn = Bactrocera neohumeralis (Lesser Queensland fruit fly) 

Cc = Ceratitis capitata (Meditteranean fruit fly) 

(see previous page for haplotype patterns and fragment length sizes) 

41

6.3.1.1.15 Composition of reagents and preparation 

A. Preparing Primers 

Preparing Primers for a 10 µM concentration 

i. Add nuclease free water to primer stock. To calculate quantity of water to add, find the nmol 

reading for each primer and move decimal place forward (to right) of the nmol reading eg. 51.7 

nmol = 517 μL of nuclease free water to be added to primer stock. 

ii. Prepare a 1 in 10 dilution of primer for final stock. eg. if preparing 500 µL, then add 450 μL of 

nuclease free water and 50 μL of primer from original stock. 

B. Preparing dNTP’s 

The final dNTP stock is prepared using individual nucleotide stocks each with initial 

concentration of 100 mM. To prepare dNTP’s for a 400 µl final stock with final concentration of 

2.5 mM use the following steps: 

• Prepare Eppendorf tubes (1.5 ml) for final stock 

• Add 360 μl nuclease free water to each Eppendorf tube 

• Add 10 µl of each dNTP to each final stock eg. 10 µl of A, 10 µl of C, 10 µl of G, 10 µl 

of T, to each tube. Mix well 

• This should make a 1 in 10 dilution = 2.5 mM. 

C. Preparing molecular weight marker (100 bp ladder) 

For 250 µg mL -1 concentration of marker:- 

• 400 µL marker 

• 200 µL loading dye 

• 600 µL ddH2O 

Proportion is 2:1:3 respectively 

D. Preparing a gel - basic equipment and materials 

• agarose powder 

• electrolytic buffer (TAE or TBE) 

• SYBR® Safe DNA gel stain (or ethidium bromide if alternative is not available) 

• loading dye (X6) 

• large glass flask and plastic jar (250 mL) 

• molecular weight marker (100 bp ladder) 

• microwave 

• plate and combs 

• pipette tips - non-aerosol 

• pipettes 

Preparation of gel 

Gel size may be 50 mL, 100 mL, or 200 mL. 

1. Use a 1.5% agarose gel for PCR product and a 2-3 % gel for digest products. 

2. Add TBE to agarose powder. 

42

3. Microwave until boiling point and solution is clear. 

4. Pour agarose into a plastic beaker and add SYBR® Safe to solution once the agarose is 

heated. Add 1 μL of SYBR® Safe to 10 ml of agarose solution. If using ethidium bromide, add 

directly to glass beaker and use the same quantity per mL, but make sure to use a 1 in 10 

ethidium bromide solution. 

5. Pour gel onto plate and allow to cool for 30 min or until gel is opaque. 

6. Run electrophoresis machine. Time will vary depending on size and density of gel eg. 250 mL 

gel can run at 90 V for 3-4 h. A 50 mL gel may run for 30 min to 1 h at 100 V. 

Viewing Results 

i. For gels with SYBR Safe, place onto the Safe Imager Transilluminator (with amber filter unit) 

and cover with camera box for viewing image on screen. If using ethidium bromide place gel 

onto a UV light trans-illuminator and cover with camera box. 

ii. Save gel image electronically or print. 

iii. A bright band at around 1500 bp indicates a positive PCR result (i.e. successful amplification 

for fruit fly DNA). 

iv. For digests, use a 100 bp ladder to determine size of fragments and compare with fragment 

size chart above in Section 6.3.1.1.13. If specimens do not match QFF group or 

Mediterranean FF, compare with other fragment profiles in Armstrong and Cameron (1998). 

6.3.2 DNA barcoding of tephritid fruit flies 

This test was developed by Mark Blacket, Linda Semeraro and Mali Malipatil, Victorian Department of 

Primary Industries (Blacket et al., 2012). 

INTRODUCTION 

Tephritid fruit fly adult specimens are primarily identified through an examination of diagnostic 

morphological characters (Table 2). Other life stages are more problematic, with only third instar 

larvae (and sometimes pupae) usually identified through visual examination. Identification of earlier life 

stages (early instars, eggs), and morphologically ambiguous adult specimens, generally requires the 

use of molecular techniques. 

DNA barcoding is a molecular method that is routinely being applied at DPI Vic to identify such 

morphologically problematic specimens. This technique involves obtaining a DNA sequence of a 

specific gene (usually the mitochondrial COI gene) from a specimen to compare with a database of 

reference specimens. There are currently many reference DNA barcoding sequences available; most 

of these were obtained through the Tephritid Fruit Fly Project 3 , which examined all known tephritid fruit 

fly species known to be agricultural pests as well as many closely related species. However, there are 

currently no peer-reviewed published DNA barcoding laboratory protocols covering all of the targeted 

tephritid species listed in Table 2 (although there have been some studies that have tested this 

approach on a limited number of species e.g. Armstrong and Ball 2005). The method outlined below 

utilises the reference information that is publicly available through the Bar Code of Life website 4 to 

assist in identifying specimens using DNA barcoding. 

DNA barcoding should ideally obtain DNA using relatively non-destructive techniques, to ensure that a 

voucher specimen is available for future morphological examinations (Floyd et al. 2010). Several 

suitable DNA extraction methods are currently available to retain voucher specimens after DNA 

3 www.dnabarcodes.org/pa/ge/boli_projects 

4 www.boldsystems.org/views/login.php 

43

extraction. For fruit fly adults a leg or the head of a specimen can be used while retaining many other 

valuable morphological features of the specimen (such as wings, thorax and abdomen). For larvae, 

anterior and posterior sections can be sectioned off and retained, preserving the morphologically 

valuable mouthparts and spiracles. Alternative even less destructive DNA extraction methods, 

involving Proteinase K digestion, will no doubt prove valuable in the future (e.g. Gilbert et al. 2007). 

AIM 

This test aims to identify fruit fly species through DNA sequencing and comparison with reference 

sequences of the DNA barcoding region, i.e. the COI gene. 

TARGETS 

This method utilises a publicly available database of reference DNA sequences from almost all of the 

relevant species of fruit flies from the Australasian region (Table 2). The small number of species (x 4, 

Table 2) that have not been sequenced to date belong to genera where many other species have 

been examined, allowing a DNA barcoding approach to at least place these species to the appropriate 

genus 5 . 

PROCEDURE 

DNA is extracted from fruit flies (adults or larvae) using a commercially available kit. It is possible to 

obtain suitable DNA from larval specimens that have been blanched in hot water during morphological 

examination prior to freezing or storing in ethanol (preferably 100%). A region of the fly genome, the 

mitochondrial Cytochrome Oxidase I (COI) gene, is amplified using PCR. This region is then 

sequenced and compared with other publicly available reference sequences to assist in species 

identification. However, some species, such as Bactrocera tryoni, are members of very closely related 

species complexes, and are thus reported as being identified to a species group (e.g. QFF group, 

rather than B. tryoni). 

This document provides supporting information for a two-step process involving: 

1. DNA Extraction Protocol for DNA barcoding – Fruit fly larvae and adults. 

2. Polymerase Chain Reaction (PCR) of the mitochondrial barcoding gene (COI) from Fruit fly 

DNA. 

Additional steps: Agarose checking gel & PCR purification (see relevant protocols) 

5 Species B. aquilonis and B. tryoni cannot be distinguished from each other at the ITS or COI region 

44

6.3.2.1.1 DNA extraction protocol for DNA barcoding – fruit fly larvae and adults 

Equipment and/or material needed 

• Blotting paper (or tissues) 

• Scalpel blades (if sub-sampling each sample) 

• Micro-centrifuge 

• Eppendorf tubes (1.5 mL) 

• QIAGEN extraction kit (DNeasy® Blood and Tissue kit) 

• Heating block to 56 o C (or waterbath) 

• Forceps 

• Vortex 

• Bead-Mill 

• 3 mm solid glass beads 

• QIAGEN DNeasy® Blood and Tissue Kit Handbook, July 2006 (for reference if required) 

Methods 

1) Allow several hours for processing (Proteinase K digest time dependent). 

2) Heat heating block to 56 o C (or use a water bath at 56 o C). 

3) Add two glass beads (3 mm solid beads, acid-washed in 10 % HCl prior to use) to a clean 

Eppendorf tube. Add 20 µL of Proteinase K to tube. 

4) Remove samples (e.g. larva, adult head or leg) from 100% ethanol and dry on blotting “tissue” 

until ethanol evaporates (approximately 1 min). If samples were “dry” frozen omit this step. 

5) Add sample to tube, cleaning forceps (ethanol wipe or flame) in between samples to prevent 

cross-contamination. Grind specimen in “Bead-Mill” (1 min @ 30 MHz). 

6) Quick-spin in centrifuge (up to 10,000 rpm). 

7) Rotate previously “outer” samples to “inner” position of the Bead-Mill (i.e. swap the inner 

Eppendorf tube insert around). Repeat Bead-Mill shaking (1 min @ 30 MHz). 

8) Repeat Bead-Mill and centrifuge steps until samples contain no large visible fragments. 

9) Add 180 µL of Buffer ATL and vortex. 

10) Incubate for 1-1 ½ h at 56 o C (possibly overnight for complete digestion). 

11) Vortex, quick-spin to remove liquid from inner lid of Eppendorf tubes. 

12) Add 200 µL of Buffer AL and 200 µL of ethanol (Buffer AL and ethanol can be premixed in a 

large tube for multiple samples, and then dispensed [400 µL] to each sample). Vortex. 

13) Pipette mixture to QIAGEN kit column and centrifuge at ~6000 x g for 1 min. Discard lower 

collection tube. 

14) Place column into a new collection tube. Add 500 µL of Buffer AW1. Centrifuge at ~6,000 x g 

for 1 min. Discard lower collection tube. 

15) Place column into a new collection tube. Add 500 µL of Buffer AW2. Centrifuge at ~20,000 x g 

(17,000 x g is acceptable) and centrifuge for 3 min. Discard lower collection tube (making sure 

no AW2 Buffer splashes onto the base of column). 

16) Label the top and side of clean 1.5 mL Eppendorf tube with the sample “VAITC” number. 

17) Place column into the new Eppendorf tube. Add 100 µL of AE buffer (this buffer must come 

into direct contact with the column filter). Incubate at room temperature for 1 min, then 

centrifuge for 1 min at 6000 x g. 

45

18) Repeat elution a second time. 

19) Discard column and retain Eppendorf tube containing 200 µL of DNA in AE Buffer. 

20) Store DNA in -20 o C freezer. 

6.3.2.1.2 Polymerase chain reaction of the mitochondrial barcoding gene (COI) from fruit fly 

DNA 

Equipment and/or material needed 

Primers: 

• Forward: FruitFlyCOI-F (FFCOI-F) 5’-GGAGCATTAATYGGRGAYG-3’ (Blacket et al., 2012 6 ) 

• Reverse: HCO 5’- TAAACTTCAGGGTGACCAAAAATCA-3’ (Folmer et al. 1994) 

PCR Master Mix: 

• BSA [1X] (diluted with dH2O from 100X BSA stock) 

• NEB 10X Buffer (Cat# M0267S) 

• dNTP’s [2.5 mM] 

• MgCl2 [25 mM] 

• Primers [10 µM] (working primer concentration is 10 µM, store stocks at 100 µm, -20 o C) 

• NEB Taq DNA Polymerase (Cat# M0267S) 

• DNA template (see Section 6.3.2.1.1. DNA extraction protocol for DNA barcoding) 

• QIAGEN QIAquick Spin Handbook, March 2008 (for reference if required) 

Methods 

1) Extract fruit fly DNA for use as template (see Section 6.3.2.1.1. DNA extraction protocol for 

DNA barcoding). 

2) Set up Master mix (keeping all reagents on ice during setup). 

3) Master Mix (25 µL reaction volume): 

1X BSA 17 

10X Buffer 2.5 

dNTP’s 2 

MgCl2 

X 1 reaction µL 

0.5 

FFCOI-F 1.25 

HCO 1.25 

NEB Taq 0.2 

DNA Template 2 

6 

This primer is a fly-specific primer that was initially successfully tested on Bactrocera, Ceratitis (Tephritidae) and Calliphora 

(Calliphoridae) species. 

46

4) PCR Conditions (use “T800”, Eppendorf (epgradient S) Thermocycler): 

1 x cycle 94 °C, 2 min 

40 x cycles 94 °C, 30 s 

52 °C, 30 s 

72 °C, 30 s 

1 x cycles 72 °C, 2 min 

1 x hold 15 °C, indefinitely 

5) After PCR is complete, load 5 µL of the PCR product (plus 2 µL loading dye) onto a 2% 

agarose checking gel (use 5 µL of SYBR Safe [Cat# S33102] per 50 mL liquid gel mix, before 

casting gel). Mix PCR product and dye together in plastic “gel loading” plate, using a new 

pipette tip for each sample. Run agarose gel at 100 V, for 30 min. Visualise and photograph 

gel on light box. 

6) Clean successful PCR products using QIAquick PCR Purification Kit (QIAGEN, Cat# 28104), 

elute final volume in 30 µL of EB Buffer. Estimate PCR product concentration from agarose 

gel photo (weak PCR ~20 ng µL -1 , strong PCR >100 ng µL -1 ). 

7) Send to external facility (e.g. Micromon, Monash University/Macrogen, Korea) for DNA 

sequencing. 

8) After high quality DNA sequences have been obtained (preferably with a QV or Phred score of 

greater than 20) they can are compared with a public database (i.e. BarCode of Life website 7 ) 

to identify species as outlined in Section 6.3.2.1.3. 

6.3.2.1.3 Data analysis – DNA barcoding identification 

Method 

1) Go to the Barcode of Life website (www.boldsystems.org/views/login.php). 

2) Click on the “Identify Specimen” tab (www.boldsystems.org/views/idrequest.php). 

3) Paste the DNA sequence (use only the high quality section of the DNA sequence) into the 

“Enter sequences in fasta format:” box (please note: there is no requirement for the sequence 

to actually be in FASTA format). 

4) Click the “Submit” button. 

5) The top 20 matches are displayed, together with the “Specimen Similarity” score (as a %). 

6) The matches with the highest percentage similarity (listed from highest to lowest) are the 

reference sequences that best match the unknown specimen being identified. 

7) It is a good idea to view the best matches as a phylogenetic tree using the “Tree based 

Identification” button. 

8) Click “View Tree” to view a PDF of the phylogenetic tree. 

9) The specimen being identified is referred to as the “Unknown Specimen” (written in red) on the 

tree (indicated with arrows in Figure 12 and Figure 13), and is shown closest to the reference 

specimens that it best matches (Figure 12). 

10) The specimen can now be assigned to the species that it is most similar to. However, please 

note that sometimes specimens can only be assigned to species groups (i.e. a closely related 

species complex, Figure 13) that are unable to be distinguished using DNA barcoding. 

7 http://www.boldsystems.org/views/idrequest.php 

47

Figure 12. Specimen confidently assigned to species (Lamprolonchaea brouniana) 

Figure 13. Specimen only confidently assigned to species group (Queensland Fruit Fly group), due to three 

closely related species (B. tryoni, B. aquilonis, B. neohumeralis) being “mixed together” (i.e. non-monophyletic) on 

the phylogenetic tree 

QFF group 

L. brouniana 

48

6.4 Allozyme electrophoresis 

6.4.1 Aim 

Allozyme electrophoresis provides a method for the rapid molecular identification of various species of 

fruit fly. 

6.4.2 Targets 

Routinely targets Bactrocera tryoni, Ceratitis capitata, Dinoxia pornia, Bactrocera papayae and 

Bactrocera jarvisi (Table 2). Additional species can be incorporated where suitable reference material 

is provided as freshly-frozen specimens. 

6.4.3 Suitability 

Suitable for the comparison of soluble protein from live, recently-dead, or freshly-frozen larvae or 

adults. The service is currently routinely provided by the South Australia Museum's Evolutionary 

Biology Unit laboratory. The procedures take 2-3 hours to complete for a single screen of up to 20 

specimens for 10 different genes. 

Given the comparative nature of the technique and its continued reliance on reference samples, it is 

important to note that additional species can only be identified as "new" (i.e. not one of the five 

reference species) unless suitable, known-identity samples can also be provided for a putative match. 

Moreover, the incorporation of additional species into the routine screening procedure may also 

require a re-evaluation of which enzyme markers are diagnostic for the species concerned, in order to 

satisfy the minimum requirement of three diagnostic genetic differences between every pair of 

species. 

6.4.4 Procedure overview 

Crude extracts of soluble protein from live, recently-dead, or freshly-frozen larvae or adults are 

compared electrophoretically against known-identity extracts representing these five species. 

Test samples are readily identifiable by their comparative allozyme profile (i.e. relative band mobility) 

at a suite of six enzyme markers, encoded by a minimum of 10 independent genes, and together able 

to unambiguously diagnose the five reference species from one another at a minimum of three 

genes 8 . 

B. aquilonis is not listed in the five target species, so this method is not designed to differentiate 

between B. tryoni and B. aquilonis. 

SPECIMEN PREPARATION 

Test specimens 

• Need to be supplied either (a) alive, (b) freshly dead and kept cool and moist, or (c) frozen 

when alive and not allowed to thaw until tested (dry ice required for transport; ice is not 

suitable) 

• Can represent any life history stage 

8 

B. aquilonis is not listed in the 5 target species, so this method is not designed to differentiate between B. tryoni and 

B. aquilonis. 

49

Reference specimens 

• Frozen specimens representing the species requiring discrimination must be available. When 

kept at -70 o C, these remain suitable for use as controls for at least 10 years 

• A single homogenized larva provides enough homogenate to act as a reference specimen on 

up to eight separate occasions. Once prepared, these reference homogenates can be stored 

at -20 o C as separate ~5 µL aliquots inside glass capillary tubes. Thus reference specimens 

for any test run are usually available as pre-prepared homogenates straight from the freezer 

Specimen Preparation (ideally in cold room at 4 o C) 

• Specimens are hand-homogenized in an equal volume of a simple homogenizing solution 

(0.02 M Tris-HCl pH 7.4 containing 2 g PVP-40, 0.5 mL 2-mercaptoethanol and 20 mg NADP 

per 100 mL) 

• ~0.5 µL of homogenate loaded directly onto each gel 

• The remaining homogenate is transferred as a series of ~5 µL aliquots into individual glass 

capillary tubes and stored at -20 o C. These samples can either be subjected to further 

allozyme analysis if doubt remains as to species identity, or used as fresh reference material 

for the species thus identified (activity declines over a 12 month period at -20 o C) 

ELECTROPHORESIS (IDEALLY IN COLD ROOM AT 4 O C) 

Allozyme analyses are conducted on cellulose acetate gels (Cellogel TM ) according to the principles 

and procedures of Richardson et al. (1986). Table 5 indicates the suite of enzymes most commonly 

used for fruit-fly genetic identifications and details the electrophoretic conditions employed for each. 

GEL INTERPRETATION 

The interpretation of allozyme gels requires some expertise; the intensity of allozyme bands changes 

over time after a gel is stained, plus banding patterns can be affected by the “freshness” of the 

specimen and by what type of gut contents are present (some plants contain compounds which affect 

fruit fly enzymes once the sample is homogenised. Richardson et al. (1986) devote an entire section 

to the interpretation of allozyme gels, but there is no substitute for experience. 

RECORDING OF RESULTS 

All gels are routinely scanned several times over the time course of stain incubation and the resultant 

JPG files archived as a permanent record. 

50

Table 5. Enzymes most commonly used for fruit-fly genetic identifications 

Enzyme Abbr E.C. 

No. 

Aconitase 

hydratase 

No. of 

genes 

Buffer 1 Run 

time 

ACON 4.2.1.3 2 B 1.5 h 

@ 

250 V 

Aminoacylase ACYC 3.5.1.14 1 C 1.5 h 

@ 

250 V 

Alcohol 

dehydrogenase 

Aspartate 

aminotransferase 

Glycerol-3phosphate 

dehyrogenase 

Glucose-6phosphate 

isomerase 

3- 

Hydroxybutyrate 

dehydrogenase 

Isocitrate 

dehydrogenase 

Malate 

dehydrogenase 

ADH 1.1.1.1 2 B 1.5 h 

@ 

250 V 

GOT 2.6.1.1 2 B 1.5 h 

@ 

250 V 

GPD 1.1.1.8 1 C 1.5 h 

@ 

250 V 

GPI 5.3.1.9 1 B 1.5 h 

@ 

250 V 

HBDH 1.1.1.30 1 B 1.5 h 

@ 

250 V 

IDH 1.1.1.42 2 B 1.5 h 

@ 

250 V 

MDH 1.1.1.37 2 C 1.5 h 

@ 

250 V 

Dipeptidase PEPA 3.4.13. 2 C 1.4 h 

@ 

250 V 

1 Code for buffers follows Richardson et al. (1986). 

Stain Species 

delineated 

Richardson et 

al. (1986) 

Manchenko 

(1994) 

Richardson et 

al. (1986) 

method 3; 

Manchenko 

(1994) 

Richardson et 

al. (1986) 

Richardson et 

al. (1986) 

Richardson et 

al. (1986) 

Richardson et 

al. (1986) 

Richardson et 

al. (1986) 

Richardson et 

al. (1986) 

B. tryoni vs B. 

jarvisi vs 

B. neohumeralis? 

C. capitata vs B. 

tryoni vs B. jarvisi / 

B. papayae vs 

D. pornia 


tryoni vs D. pornia 


tryoni / B. papayae 

vs B. jarvisi vs 

D. pornia 


tryoni / B. jarvisi / 

B. papayae vs 

D. pornia 



vs D. pornia 



/ B. jarvisi vs 

D. pornia vs 

B. neohumeralis? 

B. tryoni vs 

B. papayae 



/ B. jarvisi vs 

D. pornia 


tryoni / B. jarvisi / 

B. papayae vs 

D. pornia 

51

7 Diagnostic Information 

The family Tephritidae can be separated from all other Diptera by the shape of the subcostal vein, 

which bends abruptly through a right-angle and fades to a fold before reaching the wing edge, 

combined with the presence of setulae (small setae) along the dorsal side of vein R1. 

7.1 Simplified key to major pest fruit fly genera (after White and 

Elson-Harris 1992) 

1 Vein Sc abruptly bent forward at nearly 90°, weakened beyond the bend and ending at 

subcostal break; dorsal side of vein R1, with setulae. Wing usually patterned by coloured bands. 

Wing cell cup with an acute extension…………………......................................TEPHRITIDAE .2 

- Vein Sc not abruptly bent forward, except in the Psilidae, which lack both dorsal setulae on vein 

R1, and frontal setae. Species associated with fruit very rarely have any wing patterning. Wing 

cell cup usually without an acute extension (exceptions include some Otitidae and 

Pyrgotidae)…………………..……………………………………..Families other than Tephritidae 

2 Cell cup very narrow and extension of cell cup very long. 1st flagellomere (3rd segment of 

antenna) at least three times as long as broad. Wing pattern usually confined to a costal band 

and an anal streak. (Tropical and warm temperate Old World; adventive species in Hawaii and 

northern South America)……………….………………………BACTROCERA and DACUS (p. 54) 

- Cell cup broader and the extension shorter. 1st flagellomere shorter. Wing pattern usually 

includes some coloured 

crossbands……………………………………………………………..………………………………..3 

3 The wing vein that terminates just behind the wing apex (vein M) is curved forwards before 

merging into the wing edge. Wing pattern usually similar to Figure 85. (South America, West 

Indies and southern 

USA)…………………………..………….…………………….…………….ANASTREPHA (p. 162) 

- The wing vein that terminates just behind the wing apex (vein M) meets the wing edge at 

approximately a right angle. Wing pattern usually similar to Figure 80………………….............4 

4 Cell cup, including its extension, shaped as Figure 80. Basal cells of wing usually with spot- and 

fleck-shaped marks, giving a reticulate appearance. Scutellum convex and shiny. (Ceratitis 

capitata is found in most tropical and warm temperate areas; other spp. are 

African)…………….……………………………………..……..………………….CERATITIS (p. 154) 

- Cell cup, including its extension, shaped as Figure 91-Figure 95 Basal area of wing not 

reticulate. Scutellum fairly flat and not shiny. (Larvae develop in the fruits of Berberidaceae, 

Caprifoliaceae, Cornaceae, Cupressaceae, Elaeagnaceae, North temperate regions and South 

America).……………………………………………………………………….RHAGOLETIS (p. 185) 

52

7.2 Guide to PCR-RFLP molecular information 

ITS1 Frag length - gel: size in base pairs (bp) (visual estimate) of amplified ITS fragment, on an 

agarose gel 

HinfI: approximate size of fragment(s) in bp for restriction enzyme HinfI 

Vspl: approximate size of fragment(s) in bp for restriction enzyme VspI 

Ssp1: approximate size of fragment(s) in bp for restriction enzyme SspI 

Bsr1: approximate size of fragment(s) in bp for restriction enzyme BsrI 

Sau3a1: approximate size of fragment(s) in bp for restriction enzyme Sau3aI 

SnaB1: approximate size of fragment(s) in bp for restriction enzyme SnaBI 

Where a restriction enzyme does not cut the ITS1 sequence, or cuts only once and that is within about 

90bp of the terminus, the enzyme is scored as ‘DNC’ (does not cut). 

53

7.3 Bactrocera 

7.3.1 Bactrocera (Bactrocera) albistrigata (de Meijere) 

TAXONOMIC INFORMATION 

Common name: 

Previous scientific names: 

Dacus albistrigatus 

Dacus (Bactrocera) albistrigata 

DIAGNOSIS 

7.3.1.1.1 Morphological - Adult 

A medium sized species; face fulvous with a pair of circular to oval black spots; postpronotal lobes 

yellow (anteromedial corners black); notopleura yellow; scutum mostly black; lateral postsutural vittae 

present; medial postsutural vitta absent; mesopleural stripe reaching to anterior npl. seta dorsally; 

scutellum yellow with a broad black basal band; wing with a narrow fuscous costal band which is 

extremely pale beyond extremity of cell sc to apex of wing, a narrow dark fuscous transverse band 

across wing enclosing r-m and dm-cu crossveins, a broad fuscous to dark fuscous anal streak; cells bc 

and c pale fuscous; microtrichia in outer corner of cell c only; abdominal terga III-V orange-brown with 

a narrow to medium width medial longitudinal dark fuscous to black band over all three terga and 

lateral dark markings which vary from narrow anterolateral dark fuscous to black corners on all three 

terga to broad lateral longitudinal dark fuscous to black bands over all three terga; posterior lobe of 

male surstylus short; female with aculeus tip needle shaped (pers. comm. Drew 2010). 

7.3.1.1.2 Morphological - Larvae 

- Not available/included in this edition - 

7.3.1.1.3 Molecular 

PCR - Restriction Fragment Length Polymorphism (Section 6.3.1): 

Approximate ITS1 Frag length - gel: 850 bp 

Bsr1: DNC 

HhaI: 670, 180 

HinfI: DNC 

Sau3a1: 400, 450 

SnaB1: DNC 

Ssp1: 180, 620 

Vspl: DNC 

See also PCR-DNA barcoding (Section 6.3.2.). 

54

HOST RANGE 

Bactrocera albistrigata has been recorded on hosts from a wide range of families. These include: 

Anacardiaceae, Apocynaceae, Combretaceae, Moraceae, Myrtaceae and Verbenaceae (for a full list 

of recorded hosts see Allwood et al. 1999). 

Major commercial hosts (Allwood et al. 1999; pers. comm. Drew 2010): 


Mangifera indica mango Syzygium malaccense malay-apple 

Syzygium aqueum watery rose-apple Syzygium samarangense water apple 

DISTRIBUTION 

Andaman Islands, central to southern Thailand, Peninsular Malaysia, East Malaysia and Kalimantan 

(Borneo), Singapore, Indonesia east to Sulawesi, Christmas Island (pers. comm. Drew 2010). 

REMARKS 

Bactrocera albistrigata belongs to the frauenfeldi complex described by Drew (1989). The other 

species in the complex, B. caledoniensis, B. frauenfeldi, B. parafrauenfeldi and B. trilineola all possess 

the same basic body and wing colour patterns, however, B. albistrigata is the only species that occurs 

in South-East Asia and is distinguished by having a combination of moderately broad and elongate 

lateral postsutural vittae, face with a pair of black spots and abdominal terga III-V fulvous with dark 

colour patterns (not entirely black) (pers. comm. Drew 2010). 

PEST STATUS 

• Exotic 

• Medium level pest species 

ATTRACTANT 

Cue lure. 

FIGURES 

Figure 14. Bactrocera albistrigata 

Images courtesy of Ken Walker, Museum Victoria, www.padil.gov.au (as of 22 August 2011)) 

55

Figure 15. Bactrocera albistrigata 

Image courtesy of S. Phillips and the International Centre for the Management of Pest Fruit Flies, Griffith 

University 

56

7.3.2 Bactrocera (Bactrocera) aquilonis (May) 


Common name: Northern Territory fruit fly 


Strumeta aquilonis 

Dacus (Bactrocera) aquilonis 

DIAGNOSIS 


Medium sized species; large black facial spots present; postpronotal lobes and notopleura yellow; 

scutum pale red-brown with fuscous markings, mesopleural stripe reaching almost to anterior npl. 

seta, lateral postsutural vittae present, medial postsutural vitta absent, scutellum yellow; wing with a 

narrow fuscous costal band and broad fuscous anal streak, cells bc and c fuscous, microtrichia 

covering cell c and most of cell bc; abdominal terga III-V pale orange-brown with pale fuscous along 

anterior margin of tergum III and widening over lateral margins of that tergum, a medial longitudinal 

pale fuscous band on terga III to V; posterior lobe of male surstylus short; female with aculeus tip 

needle shaped (Drew 1989; pers. comm. Drew 2010). 






Bsr1: 600, 200 

HhaI: 650, 200 

HinfI: 770 

Sau3a1: 420 

SnaB1: DNC 

Ssp1: 570, 180 

Vspl: DNC 

See also PCR-DNA barcoding (Section 6.3.2). 

HOST RANGE 

Bactrocera aquilonis has been recorded on hosts from a wide range of families. These include: 

Annonaceae, Arecaceae, Chrysobalanaceae, Combretaceae, Curcurbitaceae, Ebenaceae, 

Elaeocarpaceae, Euphorbiaceae, Lauraceae, Meliaceae, Myrtaceae, Rosaceae, Rubiaceae, 

Rutaceae, Santalaceae and Sapotaceae (for a full list of recorded hosts see Smith et al. 1988; 

Hancock et al. 2000). 

57

Major commercial hosts (Hancock et al. 2000; pers. comm. Drew 2010): 


Anacardium occidentale cashew nut Flacourtia rukam rukam 

Annona muricata soursop Fortunella x crassifolia meiwa kumquat 

Annona reticulata bullock's heart Lycopersicon 

esculentum 

tomato 

Annona squamosa sugarapple Malpighia glabra acerola 

Averrhoa carambola carambola Malus domestica apple 

Blighia sapida akee apple Mangifera indica mango 

Capsicum annuum bell pepper Manilkara zapota sapodilla 

Chrysophyllum cainito caimito Prunus persica peach 

Citrus limon lemon Psidium guajava guava 

Citrus maxima pummelo Psidium littorale var. 

longipes 

strawberry guava 

Citrus reticulata mandarin Spondias dulcis otaheite apple 

Citrus x paradisi grapefruit Syzygium aqueum watery rose-apple 

Eriobotrya japonica loquat Syzygium jambos rose apple 

Eugenia uniflora Surinam cherry Syzygium malaccense malay-apple 

Flacourtia jangomas Indian plum Ziziphus mauritiana jujube 

DISTRIBUTION 

Northern areas of Western Australia and the Northern Territory (Hancock et al. 2000). 

REMARKS 

In the Northern Territory this species dramatically increased its host range during 1985. Since 

B. aquilonis and B. tryoni will produce viable offspring when crossed in the laboratory (Drew and 

Lambert 1986), hybridisation with B. tryoni was strongly suspected and might explain this increase 

(Smith and Chin 1987; Smith et al. 1988). By 1997, most but not all commercial production areas and 

larger towns supported populations of this fly, which attacks a wide range of cultivated hosts. 

Therefore, many of the Northern Territory host records for B. aquilonis since March 1985 are attributed 

to the suspected hybrid B. aquilonis x B. tryoni and are recorded under B. tryoni and now under B. 

aquilonis in the above table (Hancock et al. 2000). 

Bactrocera aquilonis and B. tryoni are very similar in general body and wing colour patterns. 

Bactrocera aquilonis differs in being an overall paler colour with the scutum pale red-brown and the 

abdominal terga generally fulvous without distinct fuscous markings. However, these differences are 

not easily observed. These species can also be separated on the differences on the ovipositors: apex 

of aculeus rounded and spicules with 7-10 uniform dentations in B. tryoni compared with the more 

pointed aculeus and uneven dentations in B. aquilonis (Drew 1989). 

A recent molecular genetic study of northwestern Australian fruit fly populations (Cameron et al. 2010) 

concluded that there is no genetic evidence supporting B. aquilonis as a distinct species from B. 

tryoni. They conclude that the recent increase in host range of fruit flies in northwestern Australia is 

due to local populations of B. tryoni (= B. aquilonis) utilising additional food resources from increased 

agricultural production in this region. 

58

PEST STATUS 

• Endemic 

• Minor pest species 

ATTRACTANT 

Cue lure. 

FIGURES 

Figure 16. Bactrocera aquilonis 

Image courtesy of the International Centre for the Management of Pest Fruit Flies, Griffith University 

59

Figure 17. Bactrocera aquilonis 

Image courtesy of M. Romig, International Centre for the Management of Pest Fruit Flies, Griffith University 

60

7.3.3 Bactrocera (Paratridacus) atrisetosa (Perkins) 


Common name: 


Zeugodacus atrisetosus 

Melanodacus atrisetosus 

Bactrocera (Paratridacus) atrisetosa 

DIAGNOSIS 


Medium sized species; small fuscous facial spots present; postpronotal lobes and notopleura yellow; 

scutum red-brown with irregularly shaped fuscous markings, mesopleural stripe reaching midway 

between anterior margin of notopleuron and anterior npl. seta, lateral postsutural vittae beginning 

anterior to mesonotal suture, medial postsutural vitta present, scutellum yellow; wing with a narrow 

fuscous costal band and anal streak, cells bc and c pale fulvous with microtrichia in outer ½ of cell c 

only; abdominal terga III-V orange-brown occasionally with fuscous on lateral margins of tergum III 

and generally with narrow medial fuscous band on tergum V; posterior lobe of male surstylus long; 

female with aculeus tip blunt trilobed (Drew 1989; pers. comm. Drew 2010). 




See PCR-DNA barcoding (Section 6.3.2.). 

HOST RANGE 

This species has been reared from eight host species in seven genera and three families, and is 

mainly associated with cucurbits: watermelons, honeydew and rock melons, cucumbers, pumpkins, 

zucchini, luffa and tomatoes (PaDIL 2007). 

Major commercial hosts (per. comm. Drew 1989): 


Citrullus lanatus watermelon Cucurbita pepo ornamental gourd 

Cucumis sativus cucumber Lycopersicon esculentum tomato 

DISTRIBUTION 

Known only from Papua New Guinea where if occurs at higher altitudes (Drew 1989). 

REMARKS 

Bactrocera atrisetosa is distinguished in having the costal band narrow (just overlapping R2+3), scutum 

red-brown with fuscous patterns, wings colourless, cells bc and c pale fulvous, abdominal terga III-V 

orange-brown except for a narrow medial longitudinal fuscous band on tergum V and lateral margins 

of tergum III fuscous (Drew 1989). 

61

Bactrocera atrisetosa is very similar in appearance to the endemic B. cucumis. However it differs in 

having prescutellar and supra-alar setae present. In common with B. cucumis it also lacks pecten. 

PEST STATUS 

• Exotic. 

• Medium level pest species 

ATTRACTANT 

No known record. 

FIGURES 

Figure 18. Bactrocera atrisetosa 

Image courtesy of Mr. S. Wilson and the International Centre for the Management of Pest Fruit Flies, Griffith 

University 

62

Figure 19. Bactrocera atrisetosa 


63

7.3.4 Bactrocera (Bactrocera) bryoniae (Tryon) 


Common name: 


Chaetodacus bryoniae 

Strumeta bryoniae 

Dacus (Strumeta) bryoniae 

DIAGNOSIS 


Large species; irregularly circular black facial spots present; postpronotal lobes and notopleura yellow; 

scutum dull black, mesopleural stripe slightly wider than notopleuron, lateral postsutural vittae present, 

medial postsutural vitta absent, scutellum yellow; wing with a broad fuscous costal band and anal 

streak, cells bc and c fulvous, microtrichia covering outer ½ of cell c only; abdominal terga III-V 

orange-brown with a medial and two lateral longitudinal dark bands joined along anterior margin of 

tergum III; posterior lobe of male surstylus short; female with aculeus tip needle shaped (Drew 1989; 

pers. comm. Drew 2010). 






BsrI: 600, 230 

HhaI: 620, 200 

HinfI: 760 

Sau3A1: 400 

SnaBI: DNC 

SspI: 560, 180 

Vspl: DNC 


HOST RANGE 

Bactrocera bryoniae has been recorded on hosts from five families. These include: Curcurbitaceae, 

Loganiaceae, Musaceae, Passifloraceae and Solanaceae (for a full list of recorded hosts see Hancock 

et al. 2000). 

64

Major commercial host (Drew 1989; Hancock et al. 2000): 


Capsicum annuum chilli 

Infests wild species of Cucurbitaceae and Passiflora (Hancock et al. 2000). Records from capsicum 

thought to be erroneous. 

DISTRIBUTION 

Widespread and common all over Papua New Guinea (every province except Bougainville and 

Manus), and Australia (Northern Western Australia, Northern Territory, east coast south to Sydney, 

New South Wales, and the Torres Strait Islands) (SPC 2006). 

REMARKS 

There are a number of species in Southeast Asia and the South Pacific with broad costal bands. 

However, Bactrocera bryoniae differs from these species in having costal band confluent with R4+5, 

lateral postsutural vittae ending at upper pa. seta, abdominal terga III-V red-brown with a broad, dark 

fuscous band along anterior margin of tergum III and covering lateral margins, anterolateral corners of 

terga IV and V fuscous and a medial longitudinal dark fuscous band over all 3 terga (Drew 1989). 

PEST STATUS 

• Endemic 

• Low level pest species in Queensland but not in Western Australia or the Northern Territory 

ATTRACTANT 

Cue lure, Willison's lure. 

FIGURES 

Figure 20. Bactrocera bryoniae 

Image courtesy of S. Wilson, the International Centre for the Management of Pest Fruit Flies, Griffith University 

and the Queensland Museum 

65

Figure 21. Bactrocera bryoniae 


66

7.3.5 Bactrocera (Bactrocera) carambolae Drew and Hancock 


Common name: Carambola fly 


Bactrocera sp. near dorsalis 

DIAGNOSIS 


Face fulvous with a pair of medium sized oval black spots; scutum dull black with brown behind lateral 

postsutural vittae, around mesonotal suture and inside postpronotal lobes; postpronotal lobes and 

notopleura yellow; mesopleural stripe reaching midway between anterior margin of notopleuron and 

anterior npl. seta dorsally; two broad parallel sided lateral postsutural vittae ending at or behind ia. 

seta; medial postsutural vitta absent; scutellum yellow; legs with femora fulvous with a large elongate 

oval dark fuscous to black preapical spot on outer surfaces of fore femora in some specimens, tibiae 

dark fuscous (except mid tibiae paler apically); wings with cells bc and c colourless, microtrichia in 

outer corner of cell c only, a narrow fuscous costal band slightly overlapping R2+3 and expanding 

slightly beyond apex of R2+3 across apex of R4+5, a narrow fuscous anal streak; supernumerary lobe of 

medium development; abdominal terga III-V orange-brown with a ‘T’ pattern consisting of a narrow 

transverse black band across anterior margin of tergum III and widening to cover lateral margins, a 

medium width medial longitudinal black band over all three terga, anterolateral corners of terga IV dark 

fuscous to black and rectangular in shape and anterolateral corners of tergum V dark fuscous, a pair 

of oval orange-brown shining spots on tergum V; abdominal sterna dark coloured; posterial lobe of 

male surstylus short; female with aculeus tip needle shaped (pers. comm. Drew 2010). 






BsrI: 650, 250 

HhaI: 680, 200 

HinfI: DNC 

Sau3A1: 400, 450 

SnaBI: 350, 530 

SspI: DNC 

Vspl: 355, 485 


67

HOST RANGE 

Bactrocera carambolae has been recorded on hosts from a wide range of families. These include: 

Alangiaceae, Anacardiaceae, Annonaceae, Apocynaceae, Arecaceae, Clusiaceae, Combretaceae, 

Euphorbiaceae, Lauraceae, Loganiaceae, Meliaceae, Moraceae, Myristicaceae, Myrtaceae, 

Oleaceae, Oxalidaceae, Polygalaceae, Punicaceae, Rhamnaceae, Rhizophoraceae, Rutaceae, 

Sapindaceae, Sapotaceae, Simaroubaceae, Solanaceae and Symplocaceae (for a full list of recorded 

species see Allwood et al. 1999). 

Major commercial hosts (Allwood et al. 1999): 


Averrhoa carambola carambola Syzygium jambos rose apple 

Manilkara zapota sapodilla Syzygium malaccense malacca apple 

Psidium guajava guava Syzygium samarangense wax apple 

Syzygium aqueum watery rose-apple 

DISTRIBUTION 

Southern Thailand, Peninsular Malaysia, East Malaysia, Kalimantan (Borneo), Singapore, Indonesian 

islands east to Sumbawa, Andaman Islands, Surinam, French Guiana, Brazil (pers. comm. Drew 

2010). 

REMARKS 

Bactrocera carambolae is similar to B. propinqua and some specimens of B. papayae in possessing 

broad parallel sided or subparallel lateral postsutural vittae, costal band slightly overlapping R2+3, 

abdominal terga III-V with narrow to medium width dark lateral margins, shining spots on abdominal 

tergum V pale (orange-brown to fuscous), femora entirely fulvous or with, at most, subapical dark 

spots on fore femora only, in addition to the general characteristics of the dorsalis complex. 

It differs from B. papayae in having a broad medial longitudinal black band on abdominal terga III-V, a 

broader costal band apically, and shorter male aculeus and female ovipositor and from B. propinqua in 

having a narrower medial longitudinal black band on abdominal terga III-V (in B. propinqua this band is 

very broad) and apex of the aculeus needle shaped (in B. propinqua the apex of the aculeus is 

trilobed) (pers. comm. Drew 2010). 

PEST STATUS 

• Exotic 

• High priority pest identified in the Tropical Fruit Industry Biosecurity Plan (IBP; Plant Health 

Australia) 

• This species is a major economic pest throughout the region where it occurs 

ATTRACTANT 

Methyl eugenol. 

68

FIGURES 

Figure 22. Bactrocera carambolae 


Figure 23. Bactrocera carambolae 

Image courtesy of M. Romig, the International Centre for the Management of Pest Fruit Flies, 


69

7.3.6 Bactrocera (Bactrocera) caryeae (Kapoor) 


Common name: 


Dacus (Strumeta) caryeae 

Dacus (Bactrocera) caryeae 

Bactrocera (Bactrocera) caryeae 

DIAGNOSIS 


Face fulvous with a pair of large elongate oval black spots; scutum black with a small area of dark 

brown posterolateral to lateral postsutural vittae; postpronotal lobes yellow (except anterodorsal 

corners fuscous); notopleura yellow; mesopleural stripe reaching midway between anterior margin of 

notopleuron and anterior npl. seta dorsally; two narrow lateral postsutural vittae which are either 

parallel sided or narrowing slightly posteriorly to end at or just before ia. seta; medial postsutural vitta 

absent; scutellum yellow with a broad black basal band; legs with femora fulvous with large dark 

fuscous to black preapical spots on outer surfaces of fore femora and inner surfaces of mid and hind 

femora, fore tibiae fuscous, mid tibiae fulvous, hind tibiae dark fuscous; wings with cells bc and c 

colourless, sparse microtrichia in outer corner of cell c only, a very narrow fuscous costal band 

confluent with R2+3 and remaining very narrow around apex of wing, a narrow fuscous anal streak 

contained within cell cup; supernumerary lobe of medium development; abdominal terga III-V orangebrown 

with dark fuscous to black across anterior 1/3 to 1/2 of tergum III, two broad lateral longitudinal 

dark fuscous to black bands and a narrow medial longitudinal black band over all three terga, a pair of 

oval orange-brown shining spots on tergum V; abdominal sterna dark coloured; posterial lobe of male 

surstylus short; female with aculeus tip needle shaped (pers. comm. Drew 2010). 




See PCR-DNA barcoding (Section 6.3.2). 

HOST RANGE 

Bactrocera caryeae has been recorded on hosts from six families. These include: Anacardiaceae, 

Lecythidaceae, Malpighiaceae, Myrtaceae, Rutaceae and Sapotaceae (for a full list of recorded 

species see Allwood et al. 1999). 



Citrus maxima pummelo Mangifera indica mango 

Citrus reticulata mandarin Psidium guajava guava 

DISTRIBUTION 

Southern India and Sri Lanka (pers. comm. Drew 2010). 

70

REMARKS 

Bactrocera caryeae is similar to B. kandiensis and B. arecae in possessing narrow parallel sided 

lateral postsutural vittae, preapical dark markings on at least one pair of femora in addition to the 

general characteristics of the dorsalis complex. It differs from B. arecae in possessing preapical dark 

markings on all femora (in B. arecae the preapical dark markings are on fore femora only) and from B. 

kandiensis in possessing a broad medial longitudinal dark band and broad lateral longitudinal dark 

bands over abdominal terga III-V (pers. comm. Drew 2010). 

PEST STATUS 

• Exotic 

• Bactrocera caryeae occurs in very large populations in many fruit growing areas of southern 

India and is probably responsible for much of the damage generally attributed to Bactrocera 

dorsalis 

ATTRACTANT 


FIGURES 

Figure 24. Bactrocera caryeae 


71

7.3.7 Bactrocera (Bactrocera) correcta (Bezzi) 


Common name: Guava fruit fly 


Chaetodacus correctus 

Dacus (Strumeta) correctus 

Bactrocera (Bactrocera) correcta 

DIAGNOSIS 


Face fulvous with a pair of transverse elongate black spots almost meeting in centre; scutum black 

with dark red-brown along lateral and posterior margins; postpronotal lobes and notopleura yellow; 

mesopleural stripe reaching almost to anterior npl. seta dorsally; broad parallel sided lateral 

postsutural vittae ending behind ia. seta; medial postsutural vitta absent; scutellum yellow with narrow 

black basal band; legs with all segments entirely fulvous except hind tibiae pale fuscous; wings with 

cells bc and c colourless, both cells entirely devoid of microtrichia, a narrow pale fuscous costal band 

confluent with R2+3 and ending at apex of this vein, a small oval fuscous spot across apex of R4+5, anal 

streak absent but with a pale fuscous tint within cell cup; supernumerary lobe of medium development; 

abdominal terga III-V red-brown with a ‘T’ pattern consisting of a narrow transverse black band across 

anterior margin of tergum III and a narrow medial longitudinal black band over all three terga, narrow 

black anterolateral corners on terga IV and V, a pair of oval red-brown shining spots on tergum V; 

posterior lobe of male surstylus short; female with aculeus tip needle shaped (pers. comm. Drew 

2010). 





HOST RANGE 

Bactrocera correcta has been recorded on hosts from a wide range of families. These include: 

Anacardiaceae, Annonaceae, Apocynaceae, Arecaceae, Cactaceae, Capparaceae, Caricaceae, 

Combretaceae, Curcurbitaceae, Dipterocarpaceae, Elaeocarpaceae, Euphorbiaceae, Flacourtiaceae, 

Lecythidaceae, Malpighiaceae, Meliaceae, Moraceae, Musaceae, Myristicaceae, Myrtaceae, 

Olacaceae, Oxalidaceae, Rhamnaceae, Rosaceae, Rutaceae, Sapindaceae, Sapotaceae and 

Simaroubaceae (for a full list of recorded hosts see Allwood et al. 1999). 

72



Anacardium occidentale cashew nut Psidium guajava guava 

Mangifera indica mango Syzygium samarangense water apple 

Manilkara zapota sapodilla Terminalia catappa Singapore almond 

Mimusops elengi Spanish cherry Ziziphus jujuba common jujube 

Muntingia calabura Jamaican cherry 

DISTRIBUTION 

Sri Lanka, India, Nepal, Pakistan, Myanmar, northern Thailand, southern China, Bhutan, Vietnam 

(pers. comm. Drew 2010). 

REMARKS 

Bactrocera correcta is similar to B. dorsalis in the general colour patterns of the body, wings and legs 

but differs from B. dorsalis in possessing transverse facial spots and an incomplete costal band. It is 

also similar to B. penecorrecta in the general colour patterns of the body and wings but differs from 

this species in having abdominal terga III-V mostly pale coloured (not mostly black as in B. 

penecorrecta) and the scutellum with a narrow black basal band (pers. comm. Drew 2010). 

PEST STATUS 

• Exotic 

• Major pest species, particularly in Vietnam 

ATTRACTANT 


73

FIGURES 

Figure 25. Bactrocera correcta 

Image courtesy of S. Phillips and the International Centre for the Management of Pest Fruit Flies, Griffith 

University 

74

7.3.8 Bactrocera (Austrodacus) cucumis (French) 


Common name: Cucumber fruit fly 


Dacus tryoni var. cucumis 

Dacus cucumis 

Austrodacus cucumis 

Dacus (Austrodacus) cucumis 

DIAGNOSIS 


Medium sized species; small fuscous to black facial spots present; postpronotal lobes and notopleura 

yellow; scutum orange-brown without dark markings, mesopleural stripe reaching almost to anterior 

npl. seta, lateral postsutural vittae beginning anterior to mesonotal suture, broad medial postsutural 

vitta present, scutellum yellow; wing with a narrow fuscous costal band and anal streak, cells bc and c 

pale fulvous (cell c slightly paler than cell bc), microtrichia in outer corner of cell c only; abdominal 

terga I and II orange-brown, terga III-V fulvous except for two broad lateral longitudinal orange-brown 

bands over all three terga and a narrow medial longitudinal band which is orange-brown on tergum III 

and orange-brown to dark fuscous on tergum IV and V (this band is broader on tergum V); posterior 

lobe of male surstylus long; female with aculeus tip blunt trilobed (Drew 1989; pers. comm. Drew 

2010). 






BsrI: DNC 

HhaI: 550, 180 

HinfI: DNC 

Sau3AI DNC 

SnaBI: DNC 

SspI: DNC 

Vspl: DNC 


HOST RANGE 

While cucurbits are the major hosts of this species, it has been reared at moderate to high levels from 

several other species in different plant families, including pawpaw and tomato (PaDIL 2007). 

The rare or incidental hosts (usually a single rearing) include mango, avocado, guava, carambola, 

apricot, some species of citrus, and capsicum. It is likely that most of these records could be attributed 

to fruit damage prior to oviposition. B. cucumis attacks wild cucurbits such as Diplocyclos palmatus 

and these may be reservoir hosts (CABI 2007). 

75

Bactrocera cucumis has been recorded on hosts from a wide range of families. These include: 

Anacardiaceae, Caricaceae, Combretaceae, Curcurbitaceae, Ebenaceae, Euphorbiaceae, Lauraceae, 

Myrtaceae, Oxalidaceae, Passifloraceae, Rosaceae, Rubiaceae, Rutaceae, Solanaceae and Vitaceae 

(for a full list of recorded hosts see Hancock et al. 2000). 

It is worth noting, however, that many of the host associations for this species in Hancock et al. (2000) 

are single records and are considered unusual. Hancock et al. (2000) concede that the publication 

may contain a variety of errors as only the records that could be confidently attributed to errors were 

removed. This does not rule out the possibility that many of the host association records contained 

within are still erroneous. 

Further, the revision by Hancock et al. (2000) cites a large body of work conducted as early as 1951. 

Much of the work in those earlier publications may also contain a number of errors. 

As such, the Hancock et al. (2000) publication should not be used as the sole basis for providing 

evidence of host association. 

Major commercial hosts (Drew, 1989; Hancock et al. 2000): 


Carica papaya papaw Passiflora edulis passionfruit 

Cucumis sativus cucumber Solanum lycopersicum tomato 

Cucurbita moschata pumpkin Trichosanthes anguinea guada bean 

Cucurbita pepo squash and zucchini 

DISTRIBUTION 

Eastern Queensland and northeast New South Wales although it has not been trapped as far south as 

Sydney. Hancock et al. (2000) list it as present in the Northern Territory and Torres Strait Islands but 

its presence there cannot be proven (pers. comm. Drew 2011). Although morphologically 

indistinguishable from Queensland specimens (Drew pers. comm. 2011), the Northern Territory strain 

does not infest commercial crops and in laboratory culture, failed to develop on undamaged cucurbit, 

solonaceous or other commercial hosts, but could be reared on sliced cucumber (Smith and Chin 

1987). 

REMARKS 

Bactrocera cucumis is a pale orange-brown species with medial and lateral postsutural vittae present, 

a yellow scutellum, prsc. and sa. setae absent, 4 sc. seta present and a small elongate-oval black spot 

centrally on tergum V (Drew 1989). 

Other remarks: 

In common with most species in, or close to, subgenus Zeugodacus, the scutum has three yellow 

vittae (lateral and medial stripes), four setae on the margin of the scutellum, and the males lack a 

deep V-shaped notch in posterior margin of 5th sternite. This species is unusual in that it also lacks 

both anterior supra-alar setae and prescutellar acrostichal setae, and the males lack a pecten (comb 

of setae on each postero-lateral corner of tergite 3) (CABI 2007). 

PEST STATUS 

• Endemic 

• Major pest species in Queensland. Regarded as a potential pest of fruit in the National 

Tropical Fruit IBP (page 26) 

76

ATTRACTANT 

None known, but can be captured in traps emitting ammonia. 

FIGURES 

Figure 26. Bactrocera cucumis 

Image courtesy of Mr. S. Wilson, the International Centre for the Management of Pest Fruit Flies, Griffith 

University and Queensland Museum 

Figure 27. Bactrocera cucumis 


77

7.3.9 Bactrocera (Zeugodacus) cucurbitae (Coquillett) 


Common name: Melon fly 


Dacus cucurbitae 

Chaetodacus cucurbitae 

Strumeta cucurbitae 

Dacus (Strumeta) cucurbitae 

Dacus (Zeugodacus) cucurbitae 

Bactrocera cucurbitae 

DIAGNOSIS 


Medium sized species; large black facial spots present; postpronotal lobes and notopleura yellow; 

scutum red-brown with or without fuscous markings, mesopleural stripe reaching midway between 

anterior margin of notopleuron and anterior npl. seta, lateral postsutural vittae beginning anterior to 

mesonotal suture, narrow medial postsutural vitta present, scuttelum yellow; wing with a broad fuscous 

costal band expanding into a fuscous spot at wing apex, a broad fuscous anal streak, dark fuscous 

along dm-cu crossvein, pale infuscation along r-m crossvein, cells bc and c colourless, microtrichia in 

outer corner of cell c only; abdominal terga III-V orange-brown except for a narrow transverse black 

band across anterior margin of tergum III which expands over anterolateral corners, a narrow medial 

longitudinal dark fuscous to black band over all three terga and anterolateral corners of terga IV and V 

fuscous; posterior lobe of male surstylus long; female with aculeus needle shaped (Drew 1989; pers. 

comm. Drew 2010). 


- Not available / included in this edition - 




BsrI: DNC 

HhaI: 400, 180 

HinfI: DNC 

Sau3AI: DNC 

SnaBI: DNC 

SspI: DNC 

Vspl: DNC 


HOST RANGE 

Bactrocera cucurbitae is primarily a pest of Cucurbitaceae, however it has also been recorded from 

eleven other families. These include: Agavaceae, Capparaceae, Fabaceae, Malvaceae, Moraceae, 

78

Myrtaceae, Rhamnaceae, Rutaceae, Sapotaceae, Solanaceae and Vitaceae (for a full list of recorded 

hosts see Allwood et al. 1999). 

Major commercial hosts (Drew 1989, Allwood et al. 1999): 


Coccinia grandis ivy gourd Cucurbita pepo ornamental gourd 

Cucumis melo melon Momordica charantia 

Cucumis satinus Trichosanthes cucumerina var. 

anguinea 

Cucurbita maxima giant pumpkin 

DISTRIBUTION 

snakegourd 

Widely distributed over Southeast Asia, the Indian subcontinent, southern China, northern Africa and 

Papua New Guinea. Introduced into the Mariana Islands, the Hawaiian Islands and from Papua New 

Guinea to the Solomon Islands. Present in Indonesia and East Timor. 

REMARKS 

Bactrocera cucurbitae is similar to B. emittens in possessing only a slight widening of the costal band 

in wing apex, a narrow infuscation along dm-cu crossvein and abdominal terga with ground colour 

fulvous but differs in having the spot on apex of costal band not reaching M, cells bc and c colourless, 

abdominal tergum III with a narrow transverse black band across base and tip of piercer of ovipositor 

needle shaped. The most distinctive characteristic of the adult is the wing pattern (Drew 1989). 

B. cucurbitae can appear similar to the endemic B. chorista and both are attracted to cue lure. 

B. cucurbitae has a narrower medial vitta and a larger marking at the distal end of the wing. 

PEST STATUS 

• Exotic 

• High priority pest identified in the Tropical fruit and Vegetables IBPs 

• Bactrocera cucurbitae is a very serious pest of cucurbit crops 

ATTRACTANT 

Cue lure or a mixture of methyl eugenol and cue lure (Dominiak et al. 2011). 

FIGURES 

Figure 28. Bactrocera cucurbitae 

Image courtesy of Ken Walker, Museum Victoria, www.padil.gov.au (as of 22 August 2011) 

79






80

7.3.10 Bactrocera (Bactrocera) curvipennis (Froggatt) 


Common name: 


Dacus curvipennis 

Strumeta curvipennis 

Dacus (Strumeta) curvipennis 

DIAGNOSIS 


Small species; very small pale fuscous facial spots present; postpronotal lobes and notoluera yellow; 

scutum black, mesopleural stripe reaching midway between anterior margin of notoplueron and 

anterior npl. seta, lateral postsutural vittae present, medial postsutural vitta absent, scutellum yellow; 

wing with a broad fuscous costal band and anal streak, a broad fuscous band along r-m crossvein, 

cells bc and c pale fuscous, microtichia covering cell c and outer corner of cell bc; abdominal terga III- 

V orange-brown with a narrow transverse fuscous band along anterior margin of tergum III merging 

into broad lateral black margins and with anterolateral corners of terga IV and V fuscous; posterior 

lobe of male surstylus short; female with aculeus tip needle shaped (Drew 1989; pers. comm. Drew 

2010). 






BsrI: 570, 250 

HhaI: 620, 170 

HinfI: DNC 

Sau3AI: 420 

SnaBI: DNC 

SspI: 550, 200 

Vspl: DNC 


HOST RANGE 

Bactrocera curvipennis has been recorded on hosts from two families, Rutaceae and Anacardiaceae 

(for a full list of recorded hosts see CABI 2007). 

Major commercial hosts (Drew 1989): 


Citrus reticulata mandarin 

DISTRIBUTION 

New Caledonia and one remote island in Vanuatu (Drew 1989). 

81

REMARKS 

Bactrocera curvipennis is distinct in having the mesopleural stripe not extending to the postpronotal 

lobes, microtrichia covering cell c and outer corner of cell bc, and abdominal terga III-V orange-brown 

with a very narrow transverse fuscous band across anterior margin of tergum III which merges into 

broad lateral black margins and the anterolateral corners of terga IV and V fuscous (Drew 1989). 

PEST STATUS 

• Exotic 

ATTRACTANT 


FIGURES 

Figure 31. Bactrocera curvipennis 

Image courtesy of Mr. S. Wilson and the International Centre for the Management of Pest Fruit Flies, Griffith 

University 

82

Figure 32. Bactrocera curvipennis 


83

7.3.11 Bactrocera (Paradacus) decipiens (Drew) 


Common name: Pumpkin fruit fly 


Dacus (Paradacus) decipiens 

DIAGNOSIS 


Large species; medium sized fuscous to black facial spots present; postpronotal lobes and notopluera 

yellow; scutum red-brown with two broad lateral longitudinal fuscous bands, mesoplural stripe 

reaching almost to anterior npl. seta, lateral postsutural vittae beginning anterior to mesonotal suture, 

broad medial postsutural vitta present, scutellum yellow: wing with a broad fucsous costal band and 

anal streak, an irregular recurved pale fuscous marking across wing, cells bc and c extremely pale 

fuscous (cell c paler in centre), microtrichia in outer 1/3 of cell c only; abdominal terga I-V fulvous 

except for broad lateral fuscous margins on tergum I and a narrow medial longitudinal fuscous band 

on tergum V; posterior lobe of male surstylus long; female with aculeus tip trilobed (Drew 1989; pers. 





See PCR-DNA barcoding (Section 3.3.2.). 

HOST RANGE 

Pumpkin (Cucurbita pepo) is the only recorded host. 


Scientific name Common name 

Cucurbita pepo pumpkin 

DISTRIBUTION 

Papua New Guinea (New Britain) (Drew 1989). 

REMARKS 

Bactrocera decipiens is similar to B. perplexa in possessing infuscation on wings in addition to costal 

band and anal streak but differs in having an irregular S-shaped pale fuscous marking across wing, 

microtrichia in outer 1/3 of cell c only, mesoplueral stripe not extending to postpronotal lobes, 

abdominal terga mostly fulvous with broad lateral fuscous margins on tergum I, a narrow medial 

longitudinal fuscous band on tergum V and apex of piercer of ovipositor with one pair of subapical 

lobes (Drew 1989). 

84

PEST STATUS 

• Exotic 

• A major pest of pumpkins in New Britain 

ATTRACTANT 

No known record. 

FIGURES 

Figure 33. Bactrocera decipiens 



85

Figure 34. Bactrocera decipiens 


86

7.3.12 Bactrocera (Bactrocera) dorsalis (Hendel) 


Common name: Oriental fruit fly 


Dacus dorsalis 

Dacus (Strumeta) dorsalis 

Strumeta dorsalis 

Dacus (Bactrocera) dorsalis 

Bactrocera (Bactrocera) dorsalis 

DIAGNOSIS 


Face fulvous with a pair of medium sized circular black spots; scutum black with extensive areas of 

red-brown to brown below and behind lateral postsutural vittae, around mesonotal suture, between 

postpronotal lobes and notopleura, inside postpronotal lobes; postpronotal lobes and notopleura 

yellow; mesopleural stripe reaching midway between anterior margin of notopleuron and anterior npl. 

seta dorsally; broad parallel sided lateral postsutural vittae ending behind ia. seta; medial postsutural 

vitta absent; scutellum yellow; legs with femora entirely fulvous, fore tibiae pale fuscous and hind 

tibiae fuscous; wings with cells bc and c colourless, microtrichia in outer corner of cell c only, a narrow 

fuscous costal band confluent with R2+3 and remaining very narrow around apex of wing (occasionally 

there can be a very slight swelling around apex of R4+5), a narrow pale fuscous anal streak; 

supernumerary lobe of medium development; abdominal terga III-V exhibits a range of colour patterns 

(see Drew and Hancock 1994) but possesses the basic pattern of a black ‘T’ consisting of a narrow 

transverse black band across anterior margin of tergum III, a narrow medial longitudinal black band 

over all three terga, narrow anterolateral fuscous to dark fuscous corners on terga IV and V; a pair of 

oval orange-brown to pale fuscous shining spots on tergum V; abdominal sterna dark coloured; 

posterior lobe of male surstylus short; female with aculeus tip needle shaped (pers. comm. Drew 

2010). 






BsrI: 650, 260 

HhaI: 656, 192 

HinfI: 770 

Sau3AI: DNC 

SnaBI: 326, 540 

SspI: DNC 

Vspl: DNC 


87

HOST RANGE 

Bactrocera dorsalis has been recorded on hosts from a wide range of families. These include: 

Alangiaceae, Anacardiaceae, Annonaceae, Apocynaceae, Arecaceae, Burseraceae, Capparaceae, 

Caprifoliaceae, Caricaceae, Celastraceae, Chrysobalanaceae, Clusiaceae, Combretaceae, 

Convolvulaceae, Curcurbitaceae, Ebenaceae, Elaeocarpaceae, Euphorbiaceae, Fabaceae, 

Flacourtiaceae, Lauraceae, Lecythidaceae, Malpighiaceae, Meliaceae, Moraceae, Musaceae, 

Myrtaceae, Olacaceae, Oleaceae, Oxalidaceae, Polygalaceae, Rhamnaceae, Rosaceae, Rubiaceae, 

Rutaceae, Sapindaceae, Sapotaceae, Simaroubaceae and Solanaceae (for a full list of recorded hosts 

see Allwood et al. 1999). 



Anacardium occidentale cashew nut Mimusops elengi spanish cherry 

Annona reticulata bullock's heart Muntingia calabura Jamaican cherry 

Annona squamosa sugarapple Musa banana 

Averrhoa carambola carambola Prunus armeniaca apricot 

Capsicum annuum bell pepper Prunus avium sweet cherry 

Carica papaya papaw Prunus cerasus sour cherry 

Chrysophyllum cainito caimito Prunus domestica plum 

Citrus reticulata mandarin Prunus persica peach 

Coffea arabica arabica coffee Psidium guajava guava 

Dimocarpus longan longan tree Pyrus communis European pear 

Diospyros kaki persimmon Syzygium aqueum watery rose-apple 

Malpighia glabra acerola Syzygium cumini black plum 

Malus domestica apple Syzygium jambos rose apple 

Mangifera foetida bachang Syzygium malaccense malay-apple 

Mangifera indica mango Syzygium samarangense water apple 

Manilkara zapota sapodilla 

DISTRIBUTION 

India, Sri Lanka, Nepal, Bhutan, Myanmar, southern China, Taiwan, Hong Kong, northern Thailand, 

Vietnam, Cambodia, Laos, Hawaii, Mariana Islands, Tahiti (pers. comm. Drew 2010). 

REMARKS 

Bactrocera dorsalis is similar to B. carambolae, B. papayae and B. verbascifoliae in possessing broad 

parallel sided lateral postsutural vittae, costal band confluent with or very slightly overlapping R2+3 and 

to B. papayae and B. verbascifoliae in having the costal band remaining very narrow beyond apex of 

R2+3, femora entirely fulvous and abdominal terga III-V with a narrow medial longitudinal dark band. 

It differs from B. carambolae in possessing a very narrow apical section of the costal band, narrow 

medial longitudinal dark band on abdominal terga III-V and triangular shaped anterolateral dark 

corners on abdominal terga IV and V (these markings are rectangular in B. carambolae). 

It differs from B. verbascifoliae in possessing narrow lateral dark margins on abdominal terga IV and V 

and from B. papayae in having a short male aedeagus and female ovipositor. 

88

Other dorsalis complex species that are similar to B. dorsalis are B. hantanae, B. irvingiae, B. raiensis 

and B. syzygii however, all of these species possess a broad medial longitudinal dark band on 

abdominal terga III-V and have not been recorded as having males responding to methyl eugenol. See 

Drew and Hancock (1994) for a full discussion of type specimens, relationships and synonymies. 

Following the publication on the dorsalis complex by Drew and Hancock (1994), there has been 

considerable research to investigate the integrity of many of the morphologically close species in the 

dorsalis complex. The review of Clarke et al. (2005) summarised the bulk of this research and has 

demonstrated that most taxa within the complex can be satisfactorily resolved and that the complex is 

undergoing rapid morphological change. 

PEST STATUS 

• Exotic 

• High priority pest identified in the Apple and Pear, Avocado, Banana, Citrus, Summerfruit, 

Tropical fruit and Vegetable IBPs 

• Bactrocera dorsalis is a major economic pest and utilises a wide range of commercial, edible 

and rainforest fruits 

ATTRACTANT 


FIGURES 

Figure 35. Bactrocera dorsalis 

Image courtesy of the University of Florida and the Florida Department of Agriculture and Consumer Services 

http://entomology.ifas.ufl.edu/creatures/index.htm (as of 22 August 2011) 

89

Figure 36. Bactrocera dorsalis 


90

7.3.13 Bactrocera (Bactrocera) facialis (Coquillett) 


Common name: 


Dacus facialis 

Chaetodacus facialis 

Strumeta facialis 

Dacus (Strumeta) facialis 

DIAGNOSIS 


Small species; facial spots absent; postpronotal lobes and notopleura yellow; scutum dark fuscous to 

black, mesopleural stripe reaching almost to postpronotal lobes, narrow short lateral postsutural vittae 

present, medial postsutural vitta absent, scutellum yellow; wing with a narrow fuscous costal band and 

narrow pale fuscous anal streak, cells bc and c colourless with microtrichia in outer corner of cell c 

only; abdominal terga III-V orange-brown with a moderately broad medial longitudinal fuscous to black 

band over all three terga, broad lateral fuscous to black margins on tergum III and anterolateral 

corners of terga IV and V; posterior lobe of male surstylus short; female with aculeus tip needle 

shaped (Drew 1989; pers. comm. Drew 2010). 






BsrI: 580, 250 

HhaI: 600, 180 

HinfI: DNC 

Sau3AI: 400 

SnaBI: DNC 

SspI: DNC 

Vspl: DNC 


HOST RANGE 

Bactrocera facialis has been recorded on hosts from a wide range of families. These include: 

Anacardiaceae, Combretaceae, Fabaceae, Lauraceae, Moraceae, Myrtaceae, Passifloraceae, 

Rosaceae, Rutaceae, Sapindaceae and Solanaceae(for a full list of recorded hosts see CABI 2007). 

91



Capsicum annuum bell pepper Psidium guajava guava 

Mangifera indica mango 

DISTRIBUTION 

Known from the Tongatapu I. and the Ha’apai Group, Tonga (Drew 1989). 

REMARKS 

Bactrocera facialis is distinct in having broad black lateral margins on abdominal tergum III and 

anterolaterally on terga IV and V, a moderately broad medial longitudinal black band on terga III-V and 

lateral postsutural vittae very short and narrow ending at level of sa. setae (Drew 1989). 

PEST STATUS 

• Exotic 

• Bactrocera facialis is a major pest, which causes up to 100% fruit loss in Capsicum species in 

Tonga 

ATTRACTANT 

Cue lure. 

FIGURES 

Figure 37. Bactrocera facialis 



92

Figure 38. Bactrocera facialis 


93

7.3.14 Bactrocera (Bactrocera) frauenfeldi (Schiner) 


Common name: Mango fruit fly 


Dacus frauenfeldi 

Strumeta frauenfeldi 

Dacus (Strumeta) frauenfeldi 

DIAGNOSIS 


Medium sized species; large black facial spots present; postpronotal lobes black; notopleura yellow; 

scutum glossy black, mesopleural stripe reaching midway between anterior margin of notopleuron and 

anterior npl. seta, lateral postsutural vittae present, medial postsutural vitta absent, scutellum yellow 

with a black triangle on dorsal surface; wing with a narrow extremely pale fuscous costal band and 

broad fuscous anal streak, a narrow fuscous transverse band across wing, cells bc and c pale 

fuscous, microtrichia covering most of cell c; abdominal terga III-V orange-brown with a broad medial 

and 2 broad lateral longitudinal black bands; posterior lobe of male surstylus short; female with 

aculeus tip needle shaped (Drew 1989; pers. comm. Drew 2010). 






BsrI: DNC 

HhaI: 600, 200 

HinfI: DNC 

Sau3AI: 400, 450 

SnaBI: DNC 

SspI: 180, 620 

Vspl: DNC 


HOST RANGE 

Bactrocera frauenfeldi has been recorded on hosts from a wide range of families. These include: 

Anacardiaceae, Annonaceae, Caricaceae, Clusiaceae, Combretaceae, Ebenaceae, Euphorbiaceae, 

Lecythidaceae, Loganiaceae, Malpighiaceae, Meliaceae, Moraceae, Musaceae, Myrtaceae, 

Olacaceae, Oxalidaceae, Passifloraceae, Rubiaceae, Rutaceae, Sapotaceae and Solanaceae (for a 

full list of recorded hosts see Hancock et al. 2000). 

94



Mangifera indica mango Psidium guajava guava 

Manilkara kauki Syzygium malaccense malay-apple 

DISTRIBUTION 

Widely distributed in Papua New Guinea and across the Bismark Archipelago to the Solomon Islands, 

and established in the Torres Strait and northern Queensland as far south as Townsville (CABI 2007; 


REMARKS 

Bactrocera frauenfeldi is similar to B. parafrauenfeldi and B. trilineola in having black postpronotal 

lobes and a black triangular marking on dorsal surface of scutellum extending to the apex but differs in 

possessing lateral postsutural vittae and with the black markings on the scutellum reaching the apex 

as a point. Bactrocera albistrigata, regarded as a synonym of B. frauenfeldi by Hardy and Adachi 

(1954), is a distinct species. It possesses yellow postpronotal lobes and is confined to South-east Asia 

(Drew 1989). 


This species can be separated from other members of the subgenus by the presence of a dark 

crossband from the pterostigma (cell sc), which also includes both the r-m and dm-cu crossvein. This 

runs roughly parallel to the anal stripe (diagonal mark across wing base). However, the costal band is 

very pale and often not visible at all beyond apex of R2 + 3. 

Bactrocera frauenfeldi can be identified by its entirely dark postpronotal lobes; the dark triangle 

shaped mark on the scutellum; and the short tapered lateral vittae on the scutum (CABI 2007). 

PEST STATUS 

• Established 

• A major pest fruit fly species in Papua New Guinea, attacking most locally grown tropical fruits 

and nuts (with the exception of banana which is a rare host) 

ATTRACTANT 


95

FIGURES 

Figure 39. Bactrocera frauenfeldi 


Figure 40. Bactrocera frauenfeldi 


96

7.3.15 Bactrocera (Afrodacus) jarvisi (Tryon) 


Common name: Jarvis’ fruit fly 


Chaetodacus jarvisi 

Chaetodacus jarvisi var. careya 

Dacus (Afrodacus) jarvisi 

Afrodacus jarvisi 

DIAGNOSIS 


Medium sized species; medium sized irregularly oval black facial spots present; postpronotal and 

notopluera yellow and connected by a broad yellow band; scutum red-brown, mesopleural stripe 

reaching almost to anterior npl. seta, lateral postsutural vittae present, medial postsutural vittae 

absent, wing with a narrow fuscous costal band and broad fuscous anal streak, cells bc and c 

colourless with microtrichia in outer corner of cell c only; abdominal terga III-V orange-brown except 

for a fuscous to black transverse band across anterior margin of tergum III and fuscous to black 

medial longitudinal band generally over all three terga but often variable; posterior lobe of male 

surstylus long; female with aculeus tip needle shaped (Drew 1989; pers. comm. Drew 2010). 






BsrI: 600, 250 

HhaI: 650, 180 

HinfI: 770 

Sau3AI: 420 

SnaBI: DNC 

SspI: 700 

Vspl: DNC 

See also PCR-DNA barcoding (Section 6.3.2) and Allozyme Electrophoresis (Section 6.4.). 

97

HOST RANGE 

Bactrocera jarvisi has been recorded on hosts from a wide range of families. These include: 

Anacardiaceae, Annonaceae, Arecaceae, Cactaceae, Caricaceae, Celastraceae, Chrysobalanaceae, 

Clusiaceae, Combretaceae, Curcurbitaceae, Ebenaceae, Elaeocarpaceae, Lauraceae, 

Lecythidaceae, Malpighiaceae, Meliaceae, Moraceae, Musaceae, Myrtaceae, Oleaceae, Oxalidaceae, 

Passifloraceae, Punicaceae, Rosaceae, Rubiaceae, Rutaceae, Sapindaceae, Sapotaceae and 

Solanaceae (for a full list of recorded hosts see Hancock et al. 2000). 



Mangifera indica mango Prunus persica peach 

Psidium guajava guava Musa sp. banana 

DISTRIBUTION 

Northern Australia from Broome, Western Australia to eastern Arnhem Land, Northern Territory and 

northwest Queensland, Torres Strait islands and eastern Australia from Cape York to the Sydney 

district, New South Wales (Hancock et al. 2000). Has been recorded from Indonesia (Irian Jaya) by 

White and Elson-Harris on one occasion but is not established there and should not be regarded as a 

permanent record (pers. comm. Drew 2010). 

REMARKS 

Bactrocera jarvisi is similar to B. ochracea in having a pale coloured scutum, yellow notopleura and 

abdominal terga III-V without dark lateral margins. It is distinct from this species in having a broad 

yellow band connecting postpronotal lobes and notopluera, colourless cells bc and c with microtrichia 

in outer corner of cell c only, costal band expanded slightly at apex of wing and abdominal terga III-V 

with a fuscous to black narrow band across base of tergum III and a medial longitudinal fuscous to 

black band over all three terga (Drew 1989). 

PEST STATUS 

• Endemic 

• A major pest in Queensland and the Northern Territory where it attacks a large number of fruit 

and vegetable crops 

ATTRACTANT 

Weakly attracted to cue lure in northwest Western Australia and Queensland (Drew 1989). Zingerone 

is a powerful selective male lure. A paper outlining research to this effect is currently in press (Fay 

2011). 

98

FIGURES 

Figure 41. Bactrocera jarvisi 



Figure 42. Bactrocera jarvisi 


99

7.3.16 Bactrocera (Bactrocera) kandiensis Drew and Hancock 


Common name: 


DIAGNOSIS 


Face fulvous with a pair of large oval black spots; scutum black except brown below and behind lateral 

postsutural vittae, around mesonotal suture, inside postpronotal lobes, around prsc. setae and on 

anterocentral margin; postpronotal lobes yellow (anteromedial corners red-brown); notopleura yellow; 

mesopleural stripe slightly wider than notopleuron dorsally; narrow parallel sided lateral postsutural 

vittae ending at ia. seta; medial postsutural vitta absent; scutellum yellow with a moderately broad 

black basal band; legs with femora fulvous with dark fuscous on outer apical 2/3 of fore femora, inner 

apical 1/2 of mid and inner apical 1/3 of hind femora, fore tibiae fuscous, mid tibiae fulvous and hind 

tibiae dark fuscous; wings with cells bc and c colourless, microtrichia in outer corner of cell c only, a 

narrow fuscous costal band confluent with R2+3 and remaining narrow around margin of wing to end 

between extremities of R4+5 and M, a narrow fuscous cubital streak; supernumerary lobe of medium 

development; abdominal terga III-V orange-brown with a narrow transverse black band across anterior 

margin of tergum III but not covering lateral margins, a very narrow medial longitudinal fuscous to dark 

fuscous band over all three terga (occasionally interrupted at intersegmental lines) and very narrow 

fuscous to dark fuscous anterolateral corners on terga IV and V, a pair of oval orange-brown shining 

spots on tergum V; abdominal sterna dark coloured; posterior lobe of male surstylus short; female with 

aculeus tip needle shaped (pers. comm. Drew 2010). 





HOST RANGE 

Bactrocera kandiensis has been recorded on hosts from six families, Anacardiaceae and Clusiaceae 

(for a full list of recorded hosts see Allwood et al. 1999). 

Major commercial hosts (Allwood et al. 1999; Tsuruta et al.1997): 


Anacardium occidentale cashew nut Psidium guajava guava 

Annona glabra pond apple Spondias cytherea jew plum 

Citrus maxima pummelo Syzygium aromaticum clove 

Mangifera indica mango Syzygium jambos rose apple 

Averrhoa carambola carambola Carica papaya papaya 

DISTRIBUTION 

Bactrocera kandiensis is confined to Sri Lanka (Drew and Hancock 1994). 

100

REMARKS 

Bactrocera kandiensis is similar to B. caryeae and B. neoarecae in possessing narrow parallel sided 

lateral postsutural vittae and dark patterns on the apices of all femora or, at least, on fore and mid 

femora. 

It differs from B. neoarecae in possessing a single ‘T’ pattern over abdominal terga III-V (not on each 

of the three separate terga), a narrow black basal band on the scutellum and dark markings on the 

apices of all 

femora and from B. caryeae in possessing a very narrow medial longitudinal dark band on abdominal 

terga III-V and narrow dark anterolateral corners on terga IV and V (pers. comm. Drew 2010). 

PEST STATUS 

• Exotic 

• Bactrocera kandiensis is a major pest of mangoes and is probably responsible for much of the 

damage generally attributed to B. dorsalis in Sri Lanka 

ATTRACTANT 


FIGURES 

Figure 43. Bactrocera kandiensis 


101

7.3.17 Bactrocera (Bactrocera) kirki (Froggatt) 


Common name: 


Dacus kirki 

Strumeta kirki 

Dacus (Strumeta) kirki 

DIAGNOSIS 


Medium sized species; large black facial spots present; postpronotal lobes yellow (anterodorsal 

margins black); notopluera yellow; scutum glossy black, mesoplueral stripe slightly wider than 

notopleuron, lateral and medial postsutural vittae absent, scutellum glossy black with extreme lateral 

margins yellow; wing with a narrow pale fuscous costal band and narrow fuscous anal streak, a 

narrow pale fuscous tinge around r-m and dm-cu crossveins, cells bc and c with extremely pale 

fuscous tinge and microtrichia in outer ½ of cell c only; abdominal terga glossy black except for two 

longitudinal orange-brown bands over terga II-V either side of a broad medial longitudinal glossy black 

band; posterior lobe of male surstylus short; female with aculeus tip needle shaped (Drew 1989; pers. 







BsrI: DNC 

HhaI: 680, 190 

HinfI: DNC 

Sau3AI: 400, 450 

SnaBI: DNC 

SspI: 180, 620 

Vspl: DNC 


HOST RANGE 

Bactrocera kirki has been recorded on hosts from a range of families. These include: Anacardiaceae, 

Bromeliaceae, Combretaceae, Fabaceae, Myrtaceae, Oxalidaceae, Passifloraceae, Rosaceae, 

Rutaceae, Solanaceae (for a full list of recorded hosts see CABI 2007). 




Psidium guajava guava 

102

DISTRIBUTION 

Widespread in the South Pacific islands: Western Samoa, American Samoa, Tonga, Niue and Tahiti 

(Drew 1989). 

REMARKS 

Bactrocera kirki is similar to B. setinervis in having lateral and medial postsutural vittae absent, 

scutellum yellow with a black triangle on dorsal surface and postpronotal lobes yellow but differs in 

possessing facial spots and yellow notopleura. Bactrocera kirki is unusual in that it lacks yellow vittae 

on the scutum and the scutellum is largely black except for the pale margins (Drew 1989; pers. comm. 

Drew 2010). 

PEST STATUS 

• Exotic 

• High priority pest identified in the Avocado IBP 

• Bactrocera kirki is considered a major pest, and perhaps the most significant in the South 

Pacific region 

ATTRACTANT 


FIGURES 

Figure 44. Bactrocera kirki 



103

Figure 45. Bactrocera kirki 


104

7.3.18 Bactrocera (Bactrocera) kraussi (Hardy) 


Common name: 


Dacus (Strumeta) kraussi 

Strumeta kraussi 

DIAGNOSIS 


Medium sized species; medium sized oval facial spots present; postpronotal lobes and notopleura 

yellow; scutum red-brown with irregularly shaped lateral longitudinal pale fuscous to fuscous bands, 

mesopleural stripe reaching midway between anterior margin of notopleron and anterior npl. seta, 

lateral postsutural vittae present, medial postsutural vitta absent, scutellum yellow with a broad redbrown 

to fuscous basal band; wing colourless or with a pale fulvous tint and a narrow fuscous costal 

band and broad fuscous anal streak, cells bc and c pale fulvous to fulvous with microtrichia in outer 

corner of cell c only, abdominal terga III and IV fuscous and tergum V fulvous except for broad lateral 

dark fuscous margins on terga III and IV and broad fuscous lateral margins on tergum V; posterior 

lobe of male surstylus short; female with aculeus tip needle shaped (Drew 1989; pers. comm. Drew 

2010). 





HOST RANGE 

Bactrocera kraussi has been recorded on hosts from a wide range of families. These include: 

Agavaceae, Anacardiaceae, Annonaceae, Apocynaceae, Clusiaceae, Combretaceae, Cunoniaceae, 

Davidsoniaceae, Elaeocarpaceae, Euphorbiaceae, Flacourtiaceae, Icacinaceae, Lauraceae, 

Lecythidaceae, Loganiaceae, Malpighiaceae, Meliaceae, Menispermaceae, Moraceae, Musaceae, 

Myrtaceae, Oleaceae, Oxalidaceae, Passifloraceae, Rosaceae, Rubiaceae, Rutaceae, Sapindaceae, 

Sapotaceae, Solanaceae and Thymeliaceae (for a full list of recorded hosts see Hancock et al., 2000). 

Major commercial hosts (Drew 1989, Hancock et al. 2000): 


Citrus sp. Grapefruit, mandarin, 

orange 

Musa sp. banana 


It should be noted that fruit flies are not known to attack hard green bananas (Hancock et al., 2000). 

DISTRIBUTION 

Torres Strait Islands and northeast Queensland, as far south as Townsville (Hancock et al. 2000). 

105

REMARKS 

Bactrocera kraussi is similar to all other species in the fagraea complex being a general red-brown fly, 

scutellum with a broad dark basal band and cells bc and c not covered in dense microtichia. It differs 

from B. rufescens in lacking a medial dark band on abdomen, from B. fagraea and B. russeola in 

having lateral fuscous markings on abdominal terga III and IV and from B. halfordiae in having a redbrown 

scutum with or without fuscous markings, abdomen usually fuscous over terga III and IV and 

laterally on tergum V, mesopleural stripe 1 ½ times the width of notopleuron and lateral postsutural 

vittae parallel sided (Drew 1989). 

PEST STATUS 

• Endemic 

• A moderate pest species in North Queensland 

ATTRACTANT 

Cue lure. 

FIGURES 

Figure 46. Bactrocera kraussi 


106

7.3.19 Bactrocera (Bactrocera) latifrons (Hendel) 


Common name: Solanum fruit fly 


Chaetodacus latifrons 

Bactrocera (Bactrocera) latifrons 

DIAGNOSIS 


A medium sized species; face fulvous with a pair of large oval black spots; postpronotal lobes and 

notopleura yellow; scutum dull black; lateral postsutural vittae present; medial postsutural vitta absent; 

mesopleural stripe extending to anterior npl. seta dorsally; scutellum yellow; wing with a narrow 

fuscous costal band overlapping R2+3 and expanding into a small spot around apex of R4+5, a medium 

width fuscous anal streak; cells bc and c colourless; microtrichia in outer corner of cell c only; all 

abdominal terga entirely dark orange-brown, posterior lobe of male surstylus short; female with apex 

of aculeus trilobed (pers. comm. Drew 2010). 






Bsr1: 600, 200 

HhaI: 600, 190 

HinfI: DNC 

Sau3a1: DNC 

SnaB1: DNC 

Ssp1: DNC 

Vspl: DNC 


HOST RANGE 

Bactrocera latifrons has been recorded on hosts from a wide range of families. These include: 

Lythraceae, Myrtaceae, Oleaceae, Passifloraceae, Punicaceae, Rhamnaceae, Rutaceae, 

Sapindaceae, Solanaceae and Verbenaceae (for a full list of recorded hosts see Allwood et al. 1999). 



Capsicum sp. peppers Solanum lycopersicum tomato 

Capsicum annuum bell pepper Solanum melongena eggplant 

DISTRIBUTION 

Sri Lanka, India, Pakistan through to Southern China, Japan, Taiwan, Thailand, Laos, Vietnam, 

Peninsular Malaysia, Indonesia, Hawaii, Tanzania (pers. comm. Drew 2010). 

107

REMARKS 

Bactrocera latifrons can be confused with species in the B. musae complex and the B. dorsalis 

complex in possessing similar body colour patterns. However it is distinct in having a trilobed apex on 

the aculeus and uniformly dark orange-brown abdominal terga. It is similar to B. citima in possessing a 

generally black scutum, costal band overlapping R2+3, cells bc and c colourless and parallel sided 

lateral postsutural vittae but differs from this species in having red-brown around the lateral and 

posterior margins of the scutum, femora entirely fulvous and abdominal terga III-V entirely red-brown 


PEST STATUS 

• Exotic 

• This is a pest of solanaceous crops throughout its range 

ATTRACTANT 

No known record. Alpha-ionol, known as latilure is not a strong attractant but has been patented since 

1989 (Flath et al. 1994). Latilure and cade oil were used in Jackson traps for surveys of B. latifrons in 

Tanzania (Flath et al.1994). 

FIGURES 

Figure 47. Bactrocera latifrons 

Image courtesy of Y. Martin and International Centre for the Management of Pest Fruit Flies, Griffith University 

108

7.3.20 Bactrocera (Bactrocera) melanotus (Coquillett) 


Common name: 


Dacus melanotus 

Chaetodacus melanotus 

Strumeta melanotus 

Dacus (Strumeta) melanotus 

DIAGNOSIS 


Medium sized species; facial spots absent or small and pale; postpronotal lobes yellow (anterolateral 

corners black); notopleura glossy black; scutum glossy black, mesopleural stripe reaching to 

postpronotal lobe, lateral and medial postsutural vittae absent, scutellum glossy black; wing with a 

narrow pale fuscous costal band and narrow fuscous tint in anal cell, narrow pale fuscous markings 

along r-m and dm-cu crossveins, cells bc and c colourless or with a very pale fuscous tint, microtrichia 

in outer corner of cell c only; all abdominal terga entirely glossy black; posterior lobe of male surstylus 

short; female with aculeus tip needle shaped (Drew 1989; pers. comm. Drew 2010). 





HOST RANGE 

Bactrocera melanotus has been recorded on hosts from seven families. These include: 

Anacardiaceae, Caricaceae, Combretaceae, Fabaceae, Myrtaceae, Rutaceae and Sapindaceae (for a 

full list of recorded hosts see CABI 2007). 



Citrus sp. Psidium guajava guava 


DISTRIBUTION 

Restricted to Cook Is (Drew 1989). 

REMARKS 

Bactrocera melanotus is similar to B. atra and B. perfuscain possessing an entirely black scutellum, 

scutum black with medial and lateral postsutural vittae absent, abdominal terga black but differs from 

these species in having infuscation around r-m and dm-cu crossveins. In addition, it can be separated 

from B. atra in having postpronotal lobes mostly yellow, yellow mesopleural stripe and black femora 

(Drew 1989). Bactrocera melanotus is unusual in that its scutum, scutellum and abdomen are entirely 

dark coloured (black or very dark brown) (CABI 2007). 

109

PEST STATUS 

• Exotic 

• High priority pest identified in the Avocado IBP 

• Bactrocera melanotus is considered a major pest of papaw and citrus crops 

ATTRACTANT 

Cue lure. 

FIGURES 

Figure 48. Bactrocera melanotus 


110

7.3.21 Bactrocera (Bactrocera) musae (Tryon) 


Common name: Banana fruit fly 


Chaetodacus musae 

Chaetodacus tryoni var. musa 

Chaetodacus musae var. dorsopicta 

Dacus (Strumeta) musae 

Strumeta musae 

Bactrocera (Bactrocera) musae 

DIAGNOSIS 


Medium sized species; medium sized black facial spots present; postpronotal lobes and notopleura 

yellow; scutum dull black, mesopleural stripe reaching midway between anterior margin of notopleuron 

and anterior npl. seta, lateral postsutural vittae present; medial postsutural vitta absent, scutellum 

yellow; wing with a narrow fuscous costal band and anal streak, cells bc and c colourless with 

microtrichia in outer corner of cell c only; abdominal terga III-V may vary from uniformly orange-brown 

to orange-brown with a fuscous to black medial longitudinal band and fuscous to black anterolateral 

corners on tergum III; posterior lobe of male surstylus short; female with aculeus tip needle shaped 

(Drew 1989; pers. comm. Drew 2010). 






BsrI: 600, 250 

HhaI: 630, 220 

HinfI: DNC 

Sau3AI: DNC 

SnaBI: 320, 520 

SspI: DNC 

Vspl: DNC 


HOST RANGE 

Bactrocera musae has been recorded on hosts from nine families. These include: Capparaceae, 

Caricaceae, Musaceae, Myrtaceae, Olacaceae, Passifloraceae, Rubiaceae, Rutaceae and 

Solanaceae (for a full list of recorded hosts see Hancock et al. 2000). 

111

Major commercial hosts (Drew, 1989; Hancock et al., 2000): 


Musa sp. banana 

DISTRIBUTION 

Torres Strait Islands and northeast Queensland, as far south as Townsville (Hancock et al. 2000), 

Papua New Guinea and associated islands, Bismark Archipelago and the Solomon Islands (Drew 

1989). 

REMARKS 

There are a large number of species similar to Bactrocera musae, all placed in the musae complex. It 

is similar to B. finitima and B. tinomiscii in possessing a black scutum with lateral postsutural vittae 

present and ending at ia. setae and medial postsutural vittae absent, postpronotal lobes and 

notopleura yellow, scutellum yellow with a narrow dark basal band and cells bc and c colourless. It 

differs from B. tinomiscii in having the costal band dark and extending well below R2+3, apex of piercer 

of ovipositor not curved upwards and subapical sensory setae on piercer of ovipositor consisting of 

two large and two small each side and from B. finitma in having the costal band not extending almost 

to R4+5; posterior lobe of male surstylus short; female with apex of aculeus needle shaped (pers. 


B. musae has a considerable intraspecific variation and can appear similar to B. endiandrae (endemic 

rainforest species from Queensland) and B. papayae which are also methyl eugenol attracted. 

PEST STATUS 

• Endemic 

• Minor pest of commercial bananas. 

ATTRACTANT 


FIGURES 

Figure 49. Bactrocera musae 



112


Image courtesy of Ken Walker, Museum Victoria, www.padil.gov.au (as of 22 August 2011)) 



113

7.3.22 Bactrocera (Bactrocera) neohumeralis (Hardy) 


Common name: Lesser Queensland fruit fly 


Chaetodacus humeralis 

Strumeta humeralis 

Dacus (Strumeta) tryoni var. neohumeralis 

Dacus (Strumeta) neohumeralis 

Dacus (Bactrocera) neohumeralis 

DIAGNOSIS 


Medium sized species; medium sized black facial spots present; postpronotal lobes dark brown to 

fuscous; notopleura yellow; scutum dark red-brown with dark fuscous to black markings, mesopleural 

stripe reaching midway between anterior margin of notopleuron and anterior npl. seta, lateral 

postsutural vittae present, medial postsutural vitta absent, scutellum yellow; wing with a narrow 

fuscous costal band and broad fuscous anal streak, cells bc and c fuscous, microtrichia covering cell c 

and outer ½ of cell bc; abdominal terga III-V generally dark fuscous to dull black and tending redbrown 

medially; posterior lobe of male surstylus short; female with aculeus tip needle shaped (Drew 

1989; pers. comm. Drew 2010). 






BsrI: 200, 600 

HhaI: 640, 190 

HinfI: 770 

Sau3AI: 420 

SnaBI: DNC 

SspI: 180, 570 

Vspl: DNC 

PCR - Restriction Fragment Length Polymorphism (Test 2, Section 6.3.1): 

(This species cannot be differentiated from Bactrocera tryoni) 

AluI 780-770, 240-230*, 170, 130 120 110 

DdeI 1000-980*, 270, 220, 170-160 

RsaI 530-500*, 460-440*, 410, 290 

SspI 1000, 550, 100 


114

HOST RANGE 

Bactrocera neohumeralis has been recorded on hosts from a wide range of families. These include: 

Anacardiaceae, Annonaceae, Apocynaceae, Arecaceae, Basellaceae, Cactaceae, Capparaceae, 

Caricaceae, Celastraceae, Chrysobalanaceae, Clusiaceae, Combretaceae, Davidsoniaceae, 

Ebenaceae, Elaeocarpaceae, Euphorbiaceae, Flacourtiaceae, Hippocraterceae, Lauraceae, 

Leeaceae, Lecythidaceae, Malpighiaceae, Melastomataceae, Meliaceae, Moraceae, Musaceae, 

Myrtaceae, Olacaceae, Oleaceae, Oxalidaceae, Passifloraceae, Piperaceae, Rhamnaceae, 

Rhizophoraceae, Rosaceae, Rubiaceae, Rutaceae, Santalaceae, Sapindaceae, Sapotaceae, 

Smilacaceae, Solanaceae, Verbenaceae and Vitaceae (for a full list of recorded hosts see Hancock 

et al. 2000). 

Major commercial hosts: 

A large number of important commercial/edible host fruits and vegetables (see Drew 1989; Hancock 

et al. 2000). 

DISTRIBUTION 

Common pest in Eastern Australia, south to Coffs Harbour, Torres Strait Islands and mainland Papua 

New Guinea (Drew 1989). It is not found in central and southern NSW (Osborne et al. 1997). 

REMARKS 

B. neohumeralis differs from B. tryoni in having dark postprotonotal lobes (this is a distinct character) 

in addition to being generally darker. Although these two species are very similar morphologically, 

their different daily mating periods (B. tryoni at dusk and B. neohumeralis during the middle of the day) 

are good reason to keep them separate (Drew 1989). 

PEST STATUS 

• Endemic 

• Bactrocera neohumeralis is a major pest of commercial fruit crops in Queensland, Australia, 

and in some crops it occurs in equal abundance to B. tryoni 

ATTRACTANT 

Cue lure. 

115

FIGURES 

Figure 52. Bactrocera neohumeralis 


Figure 53. Bactrocera neohumeralis 


116

7.3.23 Bactrocera (Bactrocera) occipitalis (Bezzi) 


Common name: 


Chaetodacus ferrugineus var. occipitalis 

Dacus (Strumeta) dorsalis var. occipitalis 

Dacus (Strumeta) occipitalis 

Dacus (Bactrocera) occipitalis 

Bactrocera (Bactrocera) occipitalis 

DIAGNOSIS 


Face fulvous with a pair of large oval black spots; scutum black except dark red-brown along posterior 

margin and enclosing prsc. setae, below and behind lateral postsutural vittae, around mesonotal 

suture, around anterior margin of notopleura and inside postpronotal lobes; postpronotal lobes and 

notopleura yellow; mesopleural stripe reaching midway between anterior margin of notopleuron and 

anterior npl. seta dorsally; broad parallel sided or subparallel lateral postsutural vittae ending at ia. 

seta (in some specimens the vittae end behind the ia. seta); medial postsutural vitta absent; scutellum 

yellow; legs with femora entirely fulvous, fore tibiae pale fuscous to fuscous, mid tibiae pale fuscous to 

fuscous basally tending paler apically, hind tibiae fuscous; wings with cells bc and c colourless, 

microtrichia in outer corner of cell c only, a narrow fuscous costal band distinctly overlapping R2+3 and 

widening markedly across apex of wing, a narrow fuscous anal streak; supernumerary lobe of medium 

development; abdominal terga III-V with a narrow transverse black band across anterior margin of 

tergum III and expanding to cover lateral margins, dark fuscous to black rectangular markings 

anterolaterally on tergum IV which sometimes continue to cover posterolateral margins of this tergum, 

dark fuscous to black anterolateral corners on tergum V, a very broad medial longitudinal black band 

over all three terga, a pair of oval orange-brown shining spots on tergum V; abdominal sterna dark 

coloured; posterior lobe of male surstylus short; female with apex of aculeus needle shaped (pers. 






HOST RANGE 

Allwood et al. (1999) host records are incomplete due to a lack of field host survey work through the 

area of distribution of the species (pers. comm. Drew 2010a). Bactrocera occipitalis has been 

recorded on hosts from three families, Anacardiaceae, Myrtaceae and Rutaceae (Allwood et al. 1999). 

117



Citrus microcarpa musk lime Psidium guajava guava 


DISTRIBUTION 

Philippines, East Malaysia (Sabah), Brunei, Indonesia (Kalimantan) (pers. comm. Drew 2010). 

REMARKS 

Bactrocera occipitalis is similar to some specimens of B. fuscitibia in possessing broad parallel sided 

lateral postsutural vittae, costal band overlapping R2+3, narrow to medium width dark patterns on 

lateral margins of abdominal terga III-V, shining spots on abdominal tergum V pale coloured, femora 

entirely fulvous or with a dark spot on outer apical surfaces of fore femora only and a broad medial 

longitudinal dark band on abdominal terga III-V. 

It differs from B. fuscitibia in having the anterolateral bare area on the scutum broad and lateral dark 

markings on abdominal terga IV and V of medium width (not narrow). Some populations of fruit flies 

throughout South-East Asia have been misidentified as B. occipitalis in previous literature. See Drew 

& Hancock (1994) for a complete discussion on this species and previous misidentifications (pers. 


PEST STATUS 

• Exotic 

• High priority pest identified in the Tropical fruit IBP 

• Bactrocera occipitalis is a major pest species within the dorsalis complex of South-east Asia 

ATTRACTANT 


118

FIGURES 

Figure 54. Bactrocera occipitalis 


Figure 55. Bactrocera occipitalis 


119

7.3.24 Bactrocera (Bactrocera) papayae Drew and Hancock 


Common name: Papaya fruit fly 


DIAGNOSIS 


Face fulvous with a pair of large oval black spots; scutum black with dark brown below and behind 

lateral postsutural vittae, around mesonotal suture and inside postpronotal lobes; postpronotal lobes 

and notopleura yellow; mesopleural stripe reaching midway between anterior margin of notopleuron 

and anterior npl. seta dorsally; broad parallel sided lateral postsutural vittae ending at or behind ia. 

seta; medial postsutural vitta absent; scutellum yellow; legs with femora entirely fulvous, fore and hind 

tibiae dark fuscous, mid tibiae fuscous basally and fulvous apically; wings with cells bc and c 

colourless, microtrichia in outer corner of cell c only, a narrow fuscous costal band confluent with R2+3 

or just overlapping this vein where it becomes paler and remaining narrow around wing apex (in some 

specimens there is a slight expansion or a small fish-hook shape around apex of R4+5), a narrow 

fuscous anal streak; supernumerary lobe of medium development in males and weak in females; 

abdominal terga III-V orange-brown with a ‘T’ pattern consisting of a narrow transverse black band 

across anterior margin of tergum III which expands laterally into narrow margins and a medium width 

medial longitudinal black band over all three terga, anterolateral corners of terga IV and V dark 

fuscous to black (in occasional specimens the transverse black band across anterior margin of tergum 

III is broken in the midline), a pair of oval orange-brown shining spots on tergum V; abdominal sterna 

dark coloured; posterior lobe of male surstylus short; female with apex of aculeus needle shaped 







BsrI: 650, 260 

HhaI: 650, 190 

HinfI: 770 

Sau3AI: DNC 

SnaBI: 320, 530 

SspI: 750 

Vspl: DNC 

See also PCR-DNA barcoding (Section 6.3.2) and Allozyme Electrophoresis (Section 6.4). 

120

HOST RANGE 

Bactrocera papayae has been recorded on hosts from a wide range of families. These include: 

Amaryllidaceae, Anacardiaceae, Annonaceae, Apocynaceae, Arecaceae, Boraginaceae, 

Burseraceae, Cactaceae, Caricaceae, Clusiaceae, Combretaceae, Curcurbitaceae, Dilleniaceae, 

Ebenaceae, Elaeocarpaceae, Euphorbiaceae, Fagaceae, Flacourtiaceae, Flagellariaceae, Lauraceae, 

Lecythidaceae, Leguminosae, Loganiaceae, Malpighiaceae, Meliaceae, Menispermaceae, Moraceae, 

Musaceae, Myrusticaceae, Myrsinaceae, Myrtaceae, Oleaceae, Oxalidaceae, Passifloraceae, 

Punicaceae, Rhamnaceae, Rhizophoraceae, Rosaceae, Rubiaceae, Rutaceae, Sapindaceae, 

Sapotaceae, Simaroubaceae, Solanaceae, Sterculiaceae, Tiliaceae, Ulmaceae, Verbenaceae, 

Vitaceae and Zingiberaceae (for a full list of recorded hosts see Allwood et al. 1999). 


A large number of important commercial/edible host fruits and vegetables (see Allwood et al. 1999; 


DISTRIBUTION 

Irian Jaya, Papua New Guinea, Southern Thailand, Peninsular Malaysia, East Malaysia, Brunei, 

Singapore, Indonesia provinces, Christmas Island (pers. comm. Drew 2010). 

Although Bactrocera papaya is not established in the Torres Strait Islands, occasional incursions do 

occur in the northern Torres Strait Islands. They are promptly eradicated. 

REMARKS 

Bactrocera papayae is similar to B. carambolae, B. dorsalis, B. occipitalis and B. philippinensis in 

possessing a black scutum with broad lateral postsutural vittae that are generally parallel sided and 

reaching to or behind ia. setae, a narrow costal band on the wing, abdominal terga III to V with a black 

‘T’ pattern and dark lateral margins. It differs from B. carambolae, B. dorsalis and B. occipitalis in 

having a longer aculeus in the female ovipositor (1.77 to 2.12 mm) and the costal band mostly 

confluent with R2+3 and from B. philippinensis in having a shorter male aedeagus (mean 3.0 mm). 

B. papayae and other dorsalis complex flies can appear similar to endemic fruit flies caught in methyl 

eugenol traps – namely B. endiandrae and B. musae, both of which can exhibit intraspecific variation 

that makes them appear more similar to dorsalis complex flies. The diagnostician should be familiar 

with this range of variation in the native species. 

PEST STATUS 

• Exotic 

• High priority pest identified in the Apple and Pear, Avocado, Banana, Citrus, Mango, 

Summerfruit, Tropical fruit and Vegetable IBPs 

• Bactrocera papayae is a major pest species within the dorsalis complex of South-east Asia 

ATTRACTANT 


121

FIGURES 

Figure 56. Bactrocera papayae 



Figure 57. Bactrocera papayae 


122

7.3.25 Bactrocera (Bactrocera) passiflorae (Froggatt) 


Common name: Fijian fruit fly 


Dacus passiflorae 

Chaetodacus passiflorae 

Strumeta passiflorae 

Dacus (Strumeta) passiflorae 

DIAGNOSIS 


Small species; facial spots absent; postpronotal lobes glossy black; notopleura yellow; scutum glossy 

black, mesopleural stripe reaching to or beyond anterior npl. seta, lateral and medial postsutural vittae 

absent, scutellum yellow; wing with a narrow fuscous costal band and narrow pale fuscous anal 

streak, cells bc and c colourless with microtrichia in outer corner of cell c only; abdominal terga I-IV 

glossy black and tergum V either glossy black with posterior margin dark fuscous or fuscous with a 

medial longitudinal black band; posterior lobe of male surstylus short; female with aculeus tip needle 

shaped (Drew 1989; pers. comm. Drew 2010). 






BsrI: 650, 270 

HhaI: 650, 190 

HinfI: 770 

Sau3AI: DNC 

SnaBI: DNC 

SspI: 750 

Vspl: DNC 


HOST RANGE 

The host list for Bactrocera passiflorae is large but unpublished. It is a major pest species and capable 

of attacking a wide range of commercial host plants. 

123

Major commercial hosts (White and Elson-Harris 1992): 


Anacardium occidentale cashew nut Passiflora quadrangularis giant granadilla 

Carica papaya papaw Persea americana avocado 

Citrus aurantiifolia lime Psidium guajava guava 

Citrus reticulata mandarin Solanum melongena eggplant 

Mangifera indica mango Theobroma cacao cocoa 

Passiflora edulis passionfruit 

DISTRIBUTION 

Fiji Islands, Niue, Wallis and Futuna. There is also a separate form of B. passiflorae with paler 

abdomen. This is probably an undescribed new species which occurs in Fiji, Tuvalu, Tokelau and 

possibly the Niuas group in Tonga. Its host range and potential pest status have not yet been well 

studied (SPC 2006). 

REMARKS 

Bactrocera passiflorae is similar to B. thistleoni in possessing black postpronotal lobes, scutellum 

entirely yellow, scutum black with lateral and medial postsutural vittae absent but differs in having 

facial spots absent and legs entirely fulvous (Drew 1989). 

PEST STATUS 

• Exotic 

• High priority pest identified in the Avocado and Tropical Fruit IBPs 

ATTRACTANT 

Cue lure. 

FIGURES 

Figure 58. Bactrocera passiflorae 

Image courtesy of the Secretariat of the Pacific Community Pacific Fruit Fly Web, www.spc.int/pacifly (as of 22 

August 2011) 

124

Figure 59. Bactrocera passiflorae 


125

7.3.26 Bactrocera (Bactrocera) philippinensis Drew and Hancock 


Common name: Philippine fruit fly 


DIAGNOSIS 


Face with a pair of large oval black spots; postpronotal lobes and notopleura yellow; scutum black; 

mesopleural stripes reaching midway between anterior margin of notopleura and anterior notopleural 

setae dorsally; two broad parallel sided lateral postsutural vittae ending at or behind ia. seate; 

scutellum yellow; legs with femora generally fulvous except for a small elongate dark fuscous spot on 

outer apical surfaces of fore femora in occasional specimens, all tibiae dark fuscous (mid tibiae paler 

apically); wings with cells bc and c colourless and microtrichia in outer corner of c only; costal band 

slightly overlapping R2+3 and usually expanding in a fish hook pattern on apex of R4+5; cubital streak 

narrow; abdominal terga III-V with a black ‘T’ and small dark fuscous to black anterolateral corners on 

terga IV and V; the medial longitudinal black band is narrow to medium width; posterior lobe of male 

surstylus short; ovipositor with aculeus long (1.6 – 2.1mm) and needle shaped (pers. comm. Drew 

2010). 






BsrI: 630, 250 

HhaI: 650, 190 

HinfI: 770 

Sau3AI: DNC 

SnaBI: 530, 320 

SspI: 750 

Vspl: DNC 


HOST RANGE 

The Philippines have not been the focus of a major fruit fly survey in the same manner as Malaysia 

and Thailand, and so the extent to which other fruit crops are attacked is uncertain (CABI 2007). 

Bactrocera philippinensis has been recorded on hosts from five families, Anacardiaceae, Caricaceae, 

Moraceae, Myrtaceae and Sapotaceae (for a full list of recorded hosts see Allwood et al. 1999). 

126



Carica papaya papaw Mangifera indica mango 

Citrus reticulata mandarin Syzygium malaccense malay-apple 

DISTRIBUTION 

Bactrocera philippinensis has been recorded from the Philippines and Palau (pers. comm. Drew 

2010). 

REMARKS 

Bactrocera philippinensis is similar to B. carambolae and B. papayae in possessing broad parallel 

sided lateral postsutural vittae, the costal band just overlapping R2+3, some small areas of dark colour 

on lateral margins of abdominal terga III-V, femora mostly fulvous and tip of aculeus needle shaped. 

It differs from B. carambolae in having a narrower medial longitudinal band on abdominal terga III-V 

and a longer male aedeagus and female aculeus. It differs from B. papayae in having a fish-hook barb 

pattern at the apex of the costal band and a longer male aedeagus and female aculeus (pers. comm. 

Drew 2010). 

PEST STATUS 

• Exotic 

• High priority pest identified in the Apple and Pear, Avocado, Banana, Citrus, Mango, 

Summerfruit, Tropical fruit and Vegetable IBPs 

• Bactrocera philippinensis is a very important pest of mango in the Philippines 

ATTRACTANT 


FIGURES 

Figure 60. Bactrocera philippinensis 


127

Figure 61. Bactrocera philippinensis 


128

7.3.27 Bactrocera (Bactrocera) psidii (Froggatt) 


Common name: South sea guava fruit fly 


Tephritis psidii 

Dacus psidii 

Strumeta psidii 

Dacus (Strumeta) psidii 

DIAGNOSIS 


Medium sized species; generally small fuscous to dark fuscous facial spots present; postpronotal 

lobes yellow except anterodorsal corner black; notopleura yellow; scutum glossy black, mesopleural 

stripe equal in width to notopleuron, short lateral postsutural vittae present, medial postsutural vitta 

absent, scutellum yellow with a broad triangular black marking on dorsal surface; wing with a narrow 

tint of extremely pale fuscous colouration around costal margin and a narrow fulvous anal streak, a 

narrow tint of fuscous colouration around r-m and dm-cu crossveins, cells bc and c colourless to 

extremely pale fulvous with microtrichia in outer corner of cell c only; abdominal terga entirely glossy 

black; posterior lobe of male surstylus short; female with aculeus tip needle shaped (Drew 1989; pers. 







Bsr1: DNC 

HhaI: 640, 190 

HinfI: DNC 

Sau3AI: DNC 

SnaBI: DNC 

Ssp1: 200, 550 

Vspl: DNC 


129

HOST RANGE 

Bactrocera psidii has been recorded on hosts from a wide range of families. These include: 

Anacardiaceae, Annonaceae, Apocynaceae, Caricaceae, Combretaceae, Ebenaceae, 

Euphorbiaceae, Malpighiaceae, Moraceae, Musaceae, Myrtaceae, Oxalidaceae, Passifloraceae, 

Punicaceae, Rosaceae, Rutaceae and Vitaceae (for a full list of recorded hosts see SPC 2006). 



Citrus sp. Psidium guajava guava 


DISTRIBUTION 

Restricted to New Caledonia (Drew 1989). 

REMARKS 

Bactrocera psidii is similar to B. obliqua in possessing infuscation on crossveins and the scutelum 

yellow with a broad black triangular marking on dorsal surface. It differs from this species in having the 

face fulvous with small pale spots in 75% of specimens, costal band narrow and not overlapping R2+3, 

r-m crossvein shorter than dm-cu crossvein, infuscation around crossveins very narrow and pale, legs 

entirely fulvous, lateral postsutural vittae elongated and ending before ia. setae; posterior lobe of male 

surstylus short; female with apex of aculeus needle shaped. This species is unusual in having wing 

patterning very pale (including a mark along the r-m crossvein), scutellum marked with a large black 

triangle and the abdomen entirely dark (black or dark orange-brown) (Drew 1989; pers. comm. Drew 

2010). 

PEST STATUS 

• Exotic 

• Bactrocera psidii is a major pest 

ATTRACTANT 


130

FIGURES 

Figure 62. Bactrocera psidii 


Figure 63. Bactrocera psidii 


131

7.3.28 Bactrocera (Zeugodacus) tau (Walker) 


Common name: 


Dasyneura tau 

Dacus (Zeugodacus) tau 

Bactrocera (Zeugodacus) tau 

DIAGNOSIS 


A medium sized species; face fulvous with a pair of medium sized circular to oval black spots; 

postpronotal lobes and notopleura yellow; scutum black with large areas of red-brown centrally and 

anterocentrally; lateral and medial postsutural vittae present; yellow spot anterior to mesonotal suture 

in front of lateral postsutural vittae; mesopleural stripe reaching midway between anterior margin of 

notopleuron and anterior npl. seta; scutellum entirely yellow; wing with a narrow dark fuscous costal 

band overlapping R2+3 and expanding into a distinct apical spot and broad dark fuscous anal streak; 

cells bc and c colourless; microtrichia in outer corner of cell c only; abdominal terga III-V fulvous with a 

black ‘T’ pattern and anterolateral corners of terga IV and V with broad black markings; posterior lobe 

of male surstylus short; female with apex of aculeus trilobed (pers. comm. Drew 2010). 





HOST RANGE 

Bactrocera tau has been recorded on hosts from nine families. These include: Arecaceae, 

Curcurbitaceae, Fabaceae, Loganiaceae, Moraceae, Myrtaceae, Oleaceae, Sapotaceae and Vitaceae 

(for a full list of recorded hosts see Allwood et al. 1999). 



Cucumis melo melon Manilkara zapota sapodilla 

Cucumis sativus cucumber Momordica charantia bitter gourd 

Cucurbita maxima giant pumpkin Psidium guajava guava 

Luffa acutangula angled luffa 

DISTRIBUTION 

India, Sri Lanka, Bhutan, Vietnam, Southern China, Taiwan, Thailand, Peninsular Malaysia, 

Singapore, East Malaysia and Indonesian provinces (pers. comm. Drew 2010). 

132

REMARKS 

Bactrocera tau is a very common species throughout southeast Asia. It is an economic pest species, 

mainly in cucurbit crops, but can be misidentified as it belongs to a complex of closely related species. 

The tau-complex includes Zeugodacus species with a black scutum, wings colourless except for a 

costal band and cubital streak, cells bc and c colourless or with an extremely pale tint, costal band 

overlapping R2+3 and expanding into a distinct spot at apex. Bactrocera tau is distinct in having an 

entirely yellow scutellum, abdominal terga III-V with a distinct dark ‘T’ pattern and all femora with dark 

preapical spots (pers. comm. Drew 2010). 

PEST STATUS 

• Exotic 

• A major pest of cucurbit crops 

ATTRACTANT 

Cue lure. 

FIGURES 

Figure 64. Bactrocera tau 


133



Image courtesy of S. Phillips and the International Centre for the Management of Pest 

Fruit Flies, Griffith University 

134

7.3.29 Bactrocera (Bactrocera) trilineola Drew 


Common name: 


Dacus (Strumeta) triseriatus 

DIAGNOSIS 


Medium sized species; face entirely glossy black; postpronotal lobes fuscous to black; notopleura 

yellow; scutum glossy black; mesopleural stripe reaching midway between anterior margin of 

notopleuron and anterior npl. seta, lateral and medial postsutural vittae absent, scutellum glossy black 

with lateral margins yellow; wing with a narrow extremely pale fuscous costal vein and broad fuscous 

anal streak, a narrow fuscous transverse band across wing, cells bc and c extremely pale fuscous, 

microtichia covering outer ½ of cell c only; abdominal terga mostly glossy black except for two broad 

longitudinal fulvous bands on terga II-V either side of a broad medial longitudinal glossy black band; 

posterior lobe of male surstylus short; female with aculeus tip needle shaped (Drew 1989; pers. comm. 

Drew 2010). 





HOST RANGE 

Bactrocera trilineola has been recorded on hosts from a range of families. These include: 

Anacardiaceae, Annonaceae, Caricaceae, Caesalpinaceae, Combretaceae, Lauraceae, Moraceae, 

Musaceae, Myrtaceae, Oxalidaceae, Rutaceae and Sapindaceae (for a full list of recorded hosts see 

SPC 2006). 




DISTRIBUTION 

Restricted to Vanuatu where it is common over nearly every island (Drew 1989). 

REMARKS 

Bactrocera trilineola belongs to the frauenfeldi complex. It differs from B. caledoniesis and B. 

frauenfeldi in possessing a glossy black face and in lacking lateral postsutural vittae and from B. 

parafrauenfeldi in having a glossy black face, cells bc and c extremely pale fuscous, microtrichia in 

outer ½ of cell c only, costal band present but very pale beyond subcostal cell and legs fulvous except 

apical 1/3 of hind femora and hind tibiae fuscous. The apex of piercer and the spicules on the middle 

segment of the ovipositor are similar in B. frauenfeldi and B. trilineola, however the apex of the 

aculeus is slightly more pointed in B. trilineola. 

135

PEST STATUS 

• Exotic 

ATTRACTANT 


FIGURES 

Figure 67. Bactrocera trilineola 



136

Figure 68. Bactrocera trilineola 


137

7.3.30 Bactrocera (Bactrocera) trivialis (Drew) 


Common name: 


Dacus (Strumeta) trivialis 

DIAGNOSIS 


Medium sized species; medium sized pear shaped facial spots present; postpronotal lobes and 

notopleura yellow; scutum black, mesopleural stripe ending midway between anterior margin of 

notopleuron and anterior npl. seta, lateral postsutural vittae present, medial postsutural vitta absent, 

scutellum yellow; wing with a narrow fuscous costal band and anal streak, cells bc and c colourless, 

microtrichia in outer corner of cell c only; males with all leg segments fulvous except hind tibiae 

fuscous, females with dark colour patterns on femora and tibiae; abdominal terga III-V generally black 

with a medial longitudinal fulvous area from posterior margin of tergum III to tergum V; posterior lobe 

of male surstylus short; female with apex of aculeus needle shaped (Drew 1989; pers. comm. Drew 

2010). 





HOST RANGE 

Bactrocera trivialis has been recorded on hosts from seven families. These include: Anacardiaceae, 

Combretaceae, Euphorbiaceae, Myrtaceae, Rosaceae, Rutaceae, Santalaceae and Solanaceae (for a 

full list of recorded hosts see SPC 2006). 



Capsicum frutescens chilli Prunus persica peach 

Citrus x paradisi grapefruit Psidium guajava guava 

DISTRIBUTION 

Mainland Papua New Guinea (less common in the Highlands than at low elevations), Indonesia (Irian 

Jaya) (Drew 1989). 

Although Bactrocera trivialis is not established in the Torres Strait Islands, occasional incursions do 

occur. They are promptly eradicated. 

REMARKS 

A large collection of specimens reared from grapefruit at Mt. Hagen, 1980, 1981, show sexual 

dimorphism in leg colour patterns: females possess fore, mid and apical 1/3 of hind femora dark 

138

fuscous, fore tibiae and apical four segments of fore tarsi fuscous, hind tibiae dark fuscous; males 

have all segments fulvous except hind tibiae fuscous. 

It is similar to B. cacuminata, B. nigrescens and B. opliae (dorsalis complex) in having colourless cells 

bc and c and the mesopleural stripe reaching midway between the anterior margin of notoplueron and 

anterior npl. seta. It differs from B. cacuminata and B. opiliae in having an entirely black scutum and 

from B. nigrescens in having abdominal terga III-V mostly dark fuscous to black except orange-brown 

postercentrally on tergum III and centrally on terga IV and V; posterior lobe of male surstylus short; 

female with aculeus tip needle shaped (Drew 1989). 

B. trivialis can appear similar to B. rufofuscula, an endemic north Queensland rainforest species, 

which is also trapped in cue traps. However B. trivialis has a black scutum. 


Bactrocera trivialis is similar to B. laticosta in having medium to broad lateral postsutural vittae, 

abdominal tergum III either entirely dark across tergum or with broad lateral bands, and terga IV and V 

with broad lateral longitudinal dark bands. It differs from this species in having a narrow medial 

longitudinal dark band (sometimes absent) and costal band confluent with R2+3 (Lawson et al. 2003). 

PEST STATUS 


ATTRACTANT 

Cue lure. 

FIGURES 

Figure 69. Bactrocera trivialis 



139

Figure 70. Bactrocera trivialis 


140

7.3.31 Bactrocera (Bactrocera) tryoni (Froggatt) 


Common name: Queensland fruit fly 


Tephritis tryoni 

Dacus tryoni 

Chaetodacus tryoni 

Chaetodacus tryoni var. juglandis 

Chaetodacus tryoni var. sarcocephali 

Dacus (Strumeta) tryoni 

Strumeta tryoni 

Dacus (Bactrocera) tryoni 

DIAGNOSIS 



yellow; scutum red-brown with fuscous markings, mesopleural stripe reaching midway between 

anterior margin of notopleuron and anterior npl. seta, lateral postsutural vittae present, medial 

postsutural vitta absent, scutellum yellow; wing with a narrow fuscous costal band and broad fuscous 

anal streak, cells bc and c fuscous, microtrichia covering cell c and outer ½ of cell bc; abdominal terga 

III-V generally red-brown with a medial and two broad lateral longitudinal fuscous bands over all three 

terga and joined along anterior margin of tergum III; paler forms of the abdomen are often present; 

posterior lobe of male surstylus short; female with apex of aculeus needle shaped (Drew 1989; pers. 







BsrI: 200, 600 

HhaI: 640, 190 

HinfI: 770 

Sau3AI: 420 

SnaBI: DNC 

SspI: 180, 570 

Vspl: DNC 

141

PCR - Restriction Fragment Length Polymorphism (Test 2, 6.3.1): 

AluI 780-770, 240-230*, 170, 130 120 110 

DdeI 1000-980*, 270, 220, 170-160 

RsaI 530-500*, 460-440*, 410, 290 

SspI 1000, 550, 100 


HOST RANGE 

Bactrocera tryoni has been recorded on hosts from a wide range of families. These include: 

Anacardiaceae, Annonaceae, Apocynaceae, Arecaceae, Cactaceae, Capparaceae, Caricaceae, 

Celastraceae, Clusiaceae, Combretaceae, Curcurbitaceae, Cunoniaceae, Davidsoniaceae, 

Ebenaceae, Elaeocarpaceae, Ericaceae, Euphorbiaceae, Fabaceae, Flacourtiaceae, Goodeniaceae, 

Hippocraterceae, Juglandaceae, Lauraceae, Lecythidaceae, Loganiaceae, Malpighiaceae, 

Melastomataceae, Meliaceae, Moraceae, Musaceae, Myrtaceae, Oleaceae, Oxalidaceae, 

Passifloraceae, Punicaceae, Rhamnaceae, Rosaceae, Rubiaceae, Rutaceae, Santalaceae, 

Sapindaceae, Sapotaceae, Smilacaceae, Solanaceae, Thymeliaceae, Tiliaceae, Verbenaceae, 

Vitaceae (for a full list of recorded hosts see Hancock et al. 2000). 

Major hosts (Hancock et al. 2000): 


Anacardium occidentale cashew Mangifera indica mango 

Annona atemoya atemoya Manikara zapota sapodilla 

Annona glabra pond apple Morus nigra mulberry 

Annona muricata soursop Passiflora edulis passionfruit 

Annona reticula bullock’s heart Passiflora suberosa corky passionfruit 

Averrhoa carambola carambola Prunus persica peach 

Capsicum annuum capsicum Prunus persica var. 

nucipersia 

Capsicum annuum chilli Psidium cattleianum 

(=littorale) 

nectarine 

Carica papaya papaya Psidium guajava guava 

cherry guava 

Casimiroa edulis white sapote Solanum lycopersicum tomato 

Chryosphyllum cainito star apple Syzgium aqueum water apple 

Coffea arabica coffee Syzygium forte ssp. forte white apple 

Eugenia uniflora Brazilian cherry Syzygium jambos wax jambu 

Eriobotrya japonica loquat Syzygium malacense Malay apple 

Fortunella japonica kumquat Syzygium suborbiculare red bush apple 

Malus sylvestris apple Syzygium tierneyanum river cherry 

DISTRIBUTION 

Occurs in large populations throughout eastern Australia from Cape York (Queensland) to East 

Gippsland (Victoria). It is also established in New Caledonia, Austral Islands, many islands of the 

142

society group, and has been eradicated from Easter Island (Drew et al. 1982). Despite three 

specimens being recorded from Papua New Guinea, it is most doubtful that this species is established 

there (Drew 1989). A review of the past and present distribution of Bactrocera tryoni in Australia is 

currently in press (Dominiak and Daniels 2011). 

REMARKS 

Bactrocera tryoni is similar to B. aquilonis (tryoni complex) in the general patterns of the wing, thorax 

and abdomen but Bactrocera tryoni differs in having dark fuscous patterns on the scutum and the 

abdomen. In B. aquilonis the scutum and abdomen are generally pale red-brown (pers. comm. Drew 

2010). These species can also be separated on the differences on the ovipositors: apex of aculeus 

rounded and spicules with 7-10 uniform dentations in B. tryoni compared with the more pointed 

aculeus and uneven dentations in B. aquilonis (Drew 1989). However, these differences are not easily 

observed (Cameron et al. 2010). 

PEST STATUS 

• Endemic 

• Bactrocera tryoni is the major fruit fly pest species in eastern Australia and is the target of 

major control and quarantine programmes 

ATTRACTANT 

Cue lure or a mixture of methyl eugenol and cue lure are effective at attracting Bactrocera tryoni 

(Dominiak et al. 2011). Bactrocera tryoni is also attracted to wet food lures such as protein and citrus 

juice although these lures are less effective (Dominiak et al. 2003; Dominiak and Nicol 2010). 

FIGURES 

Figure 71. Bactrocera tryoni 


143





144

7.3.32 Bactrocera (Bactrocera) umbrosa (Fabricius) 


Common name: Breadfruit fruit fly 


Dacus umbrosus 

Strumeta umbrosa 

Dacus (Strumeta) umbrosus 

Dacus (Bactrocera) umbrosus 

DIAGNOSIS 



yellow; scutum black, mesopleural stripe reaching to postpronotal lobe, lateral postsutural vittae 

present, medial postsutural vitta absent, scutellum yellow; wing with a broad fuscous costal band and 

anal streak, three transverse reddish-fuscous bands across wing with the basal one joining with the 

anal streak, cells bc and c fulvous with microtrichia in outer ½ of cell c only; abdominal terga varying 

from orange-brown with a medial longitudinal black stripe on terga IV and V to orange-brown with a 

broad medial and two broad longitudinal black bands over terga III-V; posterior lobe of male surstylus 

short; female with apex of aculeus needle shaped (Drew 1989; pers. comm. Drew 2010). 






BsrI: DNC 

HhaI: 600, 190 

HinfI: 730 

Sau3AI: 380 

SnaBI: DNC 

SspI: 680 

Vspl: DNC 


HOST RANGE 

Bactrocera umbrosa has been recorded on hosts from only the family Moraceae (for a full list of 

recorded hosts see Allwood et al. 1999). 



Artocarpus altilis breadfruit Artocarpus heterophyllus jackfruit 

145

DISTRIBUTION 

Widespread and very common in Malaysia, southern Thailand, Philippines, Indonesia, Palau, Papua 

New Guinea (much less common in the Highlands), Solomon Islands, Vanuatu and New Caledonia 


REMARKS 

Bactrocera umbrosa bears no close resemblance to other species. It is easily recognised by the three 

broad transverse bands across the wings which are red-brown, not the usual fuscous colour (Drew 

1989). 

PEST STATUS 

• Exotic 

• Major pest of Artocarpus species 

ATTRACTANT 


FIGURES 

Figure 74. Bactrocera umbrosa 



146

Figure 75. Bactrocera umbrosa 

Image courtesy of S. Sands and the International Centre for the Management of Pest Fruit Flies, Griffith 

University 

147

7.3.33 Bactrocera (Notodacus) xanthodes (Broun) 


Common name: Pacific fruit fly 


Tephrites (Dacus) xanthodes 

Dacus (Tephrites) xanthodes 

Chaetodacus xanthodes 

Dacus xanthodes 

Notodacus xanthodes 

Dacus (Notodacus) xanthodes 

DIAGNOSIS 


Medium sized species; small black facial spots present; postpronotal lobes fulvous except for a broad 

yellow band on posterior 2/3; notopleura orange-brown; scutum transparent with a shining orangebrown 

colouration and with irregular dark markings, broad lateral yellow band running from 

postpronotal lobe to end just before anterior end of lateral postsutural vitta, large yellow spot on 

pleural region in place of the normal mesopleural stripe, lateral postsutural vittae present and 

beginning anterior to mesonotal suture, medial postsutural vitta present, scutellum orange-brown with 

lateral yellow margins, wing with a narrow fuscous costal band and a broad fulvous anal streak, cells 

bc and c extremely pale fulvous with microtrichia in outer corner of cell c only, abdominal terga 

transparent and shining orange-brown with no dark markings; posterior lobe of male surstylus short; 

female with apex of aculeus needle shaped (Drew 1989; pers. comm. Drew 2010). 






BsrI: DNC 

HhaI: 670, 200 

HinfI: 680 

Sau3AI: DNC 

SnaBI: DNC 

SspI: 380, 250 

Vspl: DNC 


HOST RANGE 

Bactrocera xanthodes has been recorded on hosts from a range of families. These include: 

Anacardiaceae, Annonaceae, Apocynaceae, Caricaceae, Combretaceae, Euphorbiaceae, Lauraceae, 

Lecythidaceae, Moraceae, Passifloraceae, Rutaceae and Sapotaceae (for a full list of recorded hosts 

see SPC 2006). 

148



Artocarpus altilis breadfruit Carica papaya pawpaw 

DISTRIBUTION 

Fiji Islands, Tonga, Niue, Samoa, American Samoa, Southern group of Cook Islands, Wallis and 

Futuna. Introduced on Nauru (first detected in 1992) but subsequently eradicated by male annihilation. 

Detected in April 1998 on Raivavae (French Polynesia) but subsequently eradicated by male 

annihilation (Drew 1989). 

REMARKS 

Bactrocera xanthodes is a unique species having a pair of well-developed postpronotal lobe setae, the 

transparent integument on the head, thorax and abdomen, a soft integument particularly noticeable on 

the abdomen where the terga fold ventrally in dead specimens (Drew 1989). 


Bactrocera xanthodes belongs to subgenus Notodacus, an unusual feature of which is the presence of 

a seta on each postpronotal lobe (i.e. shoulder). It has a very distinct V-shaped notch in the apex of its 

scutellum. Bactrocera paraxanthodes has this to a lesser extent. Another unusual feature of B. 

xanthodes is that the lateral stripes (vittae) on the scutum extend forward to the postpronotal lobes 

and back down the sides of the scutellum. There is also a medial yellow stripe that extends to the 

posterior edge of the scutum (immediately before the scutellum); this stripe is shorter in B. 

paraxanthodes. The most obvious difference between the closely related B. paraxanthodes and B. 

xanthodes is that B. xanthodes has yellow lateral margins to the scutellum while B. paraxanthodes has 

dark margins (CABI 2007). 

PEST STATUS 

• Exotic 

• High priority pest identified in the Avocado and Tropical fruit IBPs 

ATTRACTANT 


149

FIGURES 

Figure 76. Bactrocera xanthodes 



Figure 77. Bactrocera xanthodes 


150

7.3.34 Bactrocera (Bactrocera) zonata (Saunders) 


Common name: Peach fruit fly 


Dasyneura zonatus 

Dacus (Strumeta) zonatus 

Bactrocera (Bactrocera) zonata 

DIAGNOSIS 


Face fulvous with a pair of medium sized oval black spots; scutum red-brown with pale fuscous 

patterning posteriorly; postpronotal lobes and notopleura yellow; mesopleural stripe reaching to or 

almost to anterior npl. seta dorsally; medium width parallel sided lateral postsutural vittae ending at or 

just behind ia. seta; medial postsutural vitta absent; scutellum yellow; legs with all segments entirely 

fulvous except apices of femora red-brown and hind tibiae pale fuscous to fuscous; wings with cells bc 

and c colourless and entirely devoid of microtrichia, a narrow fuscous costal band confluent with R2+3 

and ending at apex of this vein, a small oval fuscous spot across apex of R4+5, anal streak reduced to 

a pale tint within cell cup; supernumerary lobe of medium development; abdominal terga III-V redbrown 

with a ‘T’ pattern consisting of a narrow transverse black band across anterior margin of tergum 

III (this band is often broken in the central region) and a narrow medial longitudinal black band over all 

three terga (this band is often reduced to a stripe over parts of terga IV and V), narrow anterolateral 

fuscous corners on terga IV and V, a pair of oval red-brown shining spots on tergum V; posterior lobe 

of male surstylus short; female with apex of aculeus needle shaped (pers. comm. Drew 2010). 






BsrI: 600, 200 

HhaI: 680, 190 

HinfI: DNC 

Sau3AI: DNC 

SnaBI: 535, 330 

SspI: 750, 120 

Vspl: DNC 


151

HOST RANGE 

Bactrocera zonata has been recorded on hosts from a wide range of families. These include: 

Anacardiaceae, Annonaceae, Arecaceae, Caricaceae, Combretaceae, Curcurbitaceae, Fabaceae, 

Lecythidaceae, Malpighiaceae, Malvaceae, Myrtaceae, Punicaceae, Rosaceae, Rutaceae and 

Tiliaceae (for a full list of recorded hosts see Allwood et al. 1999). 




Prunus persica peach 

DISTRIBUTION 

Sri Lanka, India, Pakistan, Thailand, Vietnam, Mauritius and Egypt (pers. comm. Drew 2010). 

REMARKS 

Bactrocera zonata is a red brown species that is similar in general appearance to B. tryoni. It is easily 

distinguished from B. tryoni in having the costal band interrupted beyond apex of R2+3. Bactrocera 

correcta possess a similar costal band but has a black scutum and a black ‘T’ pattern on abdominal 

terga III-V (pers. comm. Drew 2010). 

PEST STATUS 

• Exotic 


• In India, Pakistan and now Egypt, it is an important fruit fly pest and causes severe damage to 

peach, guava and mango 

ATTRACTANT 


152

FIGURES 

Figure 78. Bactrocera zonata 

Image courtesy of A. Carmichael and the International Centre for the Management of Pest Fruit Flies, Griffith 

University 

153

7.4 Ceratitis 

7.4.1 Ceratitis capitata (Wiedemann) 


Common name: Mediterranean fruit fly 


Trypeta capitata 

DIAGNOSIS 


In Australia, there are no species of Ceratitis that look similar to C. capitata. Consequently, the 

following characters can be used to distinguish Ceratitis capitata from all other species of Tephritidae 

occurring in Australia. Small to medium-sized, brightly coloured flies; scutellum swollen, rounded 

above, shiny black with a thin sinuate yellow streak near base dorsally; scutum yellowish with 

numerous black areas in a characteristic pattern; abdomen yellowish with two narrow transverse lightcoloured 

bands; wing relatively broad in comparison with its length, cloudy yellow, with three brown 

bands on apical two-thirds, all separated from each other, and smaller dark irregular-shaped streaks 

within the cells in the proximal half; cell cup with its apical extension short; males with a black 

diamond-shaped expansion of the apex of the anterior orbital seta. 

These characters also distinguish C. capitata from all other species in the genus wherever they may 

occur worldwide. Several species of the subgenus Ceratitis closely resemble C. capitata in the 

thoracic pattern, the apical expansion of cell cup, the presence of dark markings in the basal half of 

the wing, and in having the anterior orbital bristle of the male modified in some way. In C. capitata, it is 

black and resembles a diamond apically rather than some other shape (Foote, Blanc and Norrbom 

1993). 






BsrI: DNC 

HhaI: DNC 

HinfI: DNC 

Sau3AI: DNC 

SnaBI: DNC 

SspI: 520, 160 

Vspl: 650, 200 

154


AluI 1300, 130, 120, 110 

DdeI 1150, 270, 220,130 

RsaI 450, 380, 290, 260, 240, 210 

SspI 1020, 520, 100 


HOST RANGE 

Ceratitis capitata is a highly polyphagous species and its pattern of host relationships from region to 

region appears to relate largely to what fruits are available (CABI 2007). It has been recorded on hosts 

from a wide range of families. These include: Anacardiaceae, Annonaceae, Apocynaceae, Arecaceae, 

Cactaceae, Caricaceae, Clusiaceae, Combretaceae, Ebenaceae, Juglandaceae, Lauraceae, 

Lythraceae, Malpighiaceae, Malvaceae, Muntingiceae, Myrtaceae, Passifloraceae, Rosaceae, 

Rubiaceae, Rutaceae, Santalaceae, Sapindaceae, Sapotaceae, Solanaceae and Vitaceae (for a full 

list of recorded hosts see CABI 2007). 

Major commercial hosts (CABI 2007): 


Annona cherimola cherimoya Malus domestica apple 

Capsicum annuum bell pepper Prunus spp. stone fruit 

Citrus spp. citrus Prunus salicina Japanese plum 

Coffea spp. coffee Psidium guajava guava 

Ficus carica fig Theobroma cacao cocoa 

DISTRIBUTION 

Native to Africa, has spread to the Mediterranean region, southern Europe and Middle east, Western 

Australia, Central and South America and Hawaii (PaDIL 2007). A review of the past and present 

distribution of Ceratitis capitata in Australia is currently in press (Dominiak and Daniels 2011). 

REMARKS 

The males of Ceratitis capitata are easily separated from all other members of the family by the black 

pointed expansion at the apex of the anterior pair of orbital setae. The females can be separated from 

most other species by the characteristic yellow wing pattern and the apical half of the scutellum being 

entirely black (White and Elson-Harris 1992). 

PEST STATUS 

• Endemic 

• High priority pest identified in the Mango IBP 

• Ceratitis capitata is an important pest in Africa and has spread to almost every other continent 

to become the single most important pest species in the family Tephritidae 

• It is ecologically adapted to regions of Mediterranean climate and less of a problem in 

subtropical and tropical areas although it can still be damaging in elevated tropical regions. 

ATTRACTANT 

Trimedlure/capilure and terpinyl acetate. 

155

FIGURES 

Figure 79. Ceratitis capitata 

Figure 80. Ceratitis capitata 

Image courtesy of Scott Bauer, USDA Agricultural Research Service, Bugwood.org 


156

7.4.2 Ceratitis (Pterandrus) rosa Karsch 


Common name: Natal fruit fly 


Pterandrus rosa 

DIAGNOSIS 


Head: Anterior pair of orbital setae not modified in any way. 

Thorax: Scutellum marked black and yellow, with yellow lines or areas meeting margin, such that 

each apical scutellar seta is based in or adjacent to a yellow stripe; male mid-femora without stout 

ventral setae; mid-tibiae with rows of stout setae along the distal half of both the anterior and posterior 

edges giving a feathered appearance. Wing length 4-6 mm. 

The males of most species of subgenus Pterandrus have rows of stout setae on both the anterior and 

posterior edges of each mid-tibia, giving a feathered appearance. Ceratitis rosa can be separated from 

most other members of this subgenus by having this feathering confined to the distal half of the tibia 

and by lacking stout setae on the underside of the mid-femur. The males also lack the spatulate head 

appendages of subgenus Ceratitis. Unfortunately there is no simple method of recognizing females, 

except that Pterandrus species tend to have brown wing bands and a generally brown body colour, 

which contrasts with the yellow markings of C. capitata. 






BsrI: DNC 

HhaI: DNC 

HinfI: 800, 200 

Sau3AI: DNC 

SnaBI: DNC 

SspI: 570, 480 

Vspl: 600, 300 


HOST RANGE 

Ceratitis rosa has been recorded on hosts from a wide range of families. These include: 

Anacardiaceae, Annonaceae, Apocynaceae, Caricaceae, Clusiaceae, Combretaceae, Lauraceae, 

Malvaceae, Moraceae, Myrtaceae, Oxalidaceae, Rhamnaceae, Rosaceae, Rubiaceae, Rutaceae, 

Sapindaceae, Sapotaceae, Solanaceae, and Vitaceae (for a full list of recorded hosts see CABI 2007). 

157

Major commercial hosts (UF & FDACS 2009; CABI 2007): 


Coffea arabica coffee Prunus persica peach 

Citrus spp. citrus Psidium spp. guava 

DISTRIBUTION 

Angola, Ethiopia, Kenya, Malawi, Mali, Mozambique, Nigeria, Republic of South Africa (KwaZulu 

Natal), Rwanda, Rhodesia, Swaziland, Tanzania, Uganda, Zaire, and the islands of Mauritius and 

Reunion (UF & FDACS 2009). 

REMARKS 

Ceratitis rosa is best recognised by its characteristic pattern of brown wing bands, the three black 

areas in the apical half of the scutellum, and by the male having feathering on the mid tibiae, but no 

feathering on the mid femora (White and Elson-Harris 1992). This fruit fly closely resembles the 

Mediterranean fruit fly in appearance. It averages slightly larger and has characteristic picture wings 

and dark black spots on the thorax. The arista of the antenna is plumose, while that of the C. capitata 

bears only short pubescence. The front of the male lacks the pair of conspicuous spatulate setae 

which is found on the male C. capitata. The mesothoracic tibiae of the males are clothed with dorsal 

and ventral brushes of elongated bluish-black scales, lacking in the C. capitata. The ovipositor sheath 

of the female is shorter than the width at its base. Length of the fly 4 to 5 mm (UF & FDACS 2009). 

PEST STATUS 

• Exotic 

• High priority pest identified in the Mango IBP 

• Ceratitis rosa is highly polyphagous and causes damage to a very wide range of unrelated 

fruit crops 

ATTRACTANT 

Trimedlure and terpinyl acetate. 

158

FIGURES 

Figure 81. Ceratitis rosa 

Image courtesy of Carroll et al., Pest fruit flies of the world, http://delta-intkey.com/ffa (as of 22 August 2011) 

Figure 82. Ceratitis rosa 


159

7.5 Dirioxa 

7.5.1 Dirioxa pornia (Walker) 


Common name: Island fly 


Trypeta pornia 

DIAGNOSIS 


Head with arista plumose on dorsal surface, bare on ventral surface; thorax with scutum mostly redbrown, 

6 scutellar setae; scutellum flat and bare of microsetae; legs with one strong apical spine on 

mid tibiae; wing pattern as per Figure 83; abdominal terga fulvous with transverse black patterns on 

terga III to V; male surstylus short and thick; female aculeus rounded and blunt at apex (pers. comm. 

Drew 2010). 






BsrI: DNC 

HhaI: DNC 

HinfI: DNC 

Sau3AI: DNC 

SnaBI: DNC 

SspI: 300, 220 

Vspl: DNC 


HOST RANGE 

Dirioxa pornia attacks ripe, damaged and fallen fruit. It has been recorded on hosts from a wide range 

of families. These include: Anacardiaceae, Annonaceae, Araucariaceae, Capparaceae, Caricaceae, 

Clusiaceae, Combretaceae, Curcurbitaceae, Ebenaceae, Euphorbiaceae, Fabaceae, Lauraceae, 

Lecythidaceae, Loganiaceae, Moraceae, Musaceae, Myrtaceae, Oleaceae, Oxalidaceae, 

Passifloraceae, Proteaceae, Rosaceae, Rubiaceae, Rutaceae, Sapindaceae, Sapotaceae, 

Solanaceae and Xanthophyllaceae (for a full list of recorded hosts see Hancock et al. 2000). 

Major hosts: No major host fruits have been identified but has created occasional quarantine 

problems. 

DISTRIBUTION 

Eastern Australia, from Iron Range, Cape York Peninsula, to southern New South Wales. Introduced 

to Perth, Western Australia. (Hancock et al. 2000). Also in Northern Victoria. 

160

REMARKS 

Dirioxa spp. are the only tephritids with six setae on the scutellar margin, that are likely to be found in 

fruit crops; the wing pattern is characteristic (White and Elson-Harris 1992). 

PEST STATUS 

• Endemic 

ATTRACTANT 

Protein and citrus juice (Dominiak et aI. 2003). 

FIGURES 

Figure 83. Dirioxa pornia 

Image courtesy of Carroll et al., Pest fruit flies of the world, http://delta-intkey.com/ffa (as of 22 August 

2011) 

161

7.6 Anastrepha 

7.6.1 Anastrepha fraterculus (Wiedemann) 


Common name: South American fruit fly 


Dacus fraterculus 

Trypeta fraterculus 

Acrotoxa fraterculus 

Trypeta (Acrotoxa) fraterculus 

DIAGNOSIS 


Among all Anastrepha species found in the Americas, A. fraterculus, A. obliqua and A. suspensa 

present the most difficult identification problems in the genus; these three species are likely to be 

confused because of the similarity of their external features. Critical differences between A. fraterculus 

and A. obliqua are: 

A. A. frateculus: 

B. A. obliqua: 

a. Aculeus usually longer than the distance on vein M from the junction of MP and M to 

vein r-m. 

b. Subscutellum darkened laterally 

a. Aculeus always shorter than the distance on vein M from the junction of MP and M to 

vein r-m. 

b. Subscutellum not darkened laterally. 

The apical arm of the S band of A. fraterculus is narrow compared with that of A. suspensa. There is 

frequently a distinct scutoscutellar black spot, but it is usually smaller than in A. suspensa. One of the 

most important distinguishing features is the nature of the aculeus tip, which has serrations only on its 

apical third in contrast to that of A. obliqua (Foote, Blanc and Norrbom 1993). 





162

HOST RANGE 

Anastrepha fraterculus has been recorded on hosts from a wide range of families. These include: 

Actinidiaceae, Anacardiaceae, Annonaceae, Combretaceae, Ebenaceae, Fabaceae, Juglandaceae, 

Lauraceae, Lythraceae, Malvaceae, Moraceae, Myrtaceae, Oleaceae, Oxalidaceae, Rosaceae, 

Rubiaceae, Rutaceae, Sapotaceae and Vitaceae (for a full list of recorded hosts see CABI 2007). 



Annona cherimola cherimoya Prunus persica peach 

Citrus spp. citrus Psidium guajava guava 

Eugenia uniflora Surinam cherry Syzygium jambos rose apple 

DISTRIBUTION 

Northern Mexico south to northern Argentina, Trinidad; introduced to Galapagos Is.; occasionally 

trapped in USA (southern Texas), but not currently established (Carroll et al. 2002). 

REMARKS 

Anastrepha fraterculus is believed to belong to a group of closely related sibling species which, to 

date, have not been identified and described. In addition, it is very close to A. obliqua and A. 

suspensa. Consequently, A. fraterculus is difficult to diagnose and its exact area of distribution 

uncertain. It is regarded as a species of major economic importance (pers. comm. Drew 2010). 

PEST STATUS 

• Exotic 

• High priority pest identified in the Citrus IBP 

• Anastrepha fraterculus is an important pest of guavas and mangoes, and also to some extent 

of Citrus spp. and Prunus spp. 

ATTRACTANT 

No known record, but can be captured in traps emitting ammonia. 

163

FIGURES 

Figure 84. Anastrepha fraterculus 


Figure 85. Anastrepha fraterculus 


164

7.6.2 Anastrepha ludens (Loew) 


Common name: Mexican fruit fly 


Trypeta ludens 

Acrotoxa ludens 

Trypeta (Acrotoxa) ludens 

DIAGNOSIS 


Anastrepha ludens is characterized by a relatively long aculeus and oviscape, the former 3.4 - 4.7mm 

long and the latter correspondingly long and tapering in its apical third. This external character alone 

will alert the identifier to the possibility of A. ludens. The apical third of the aculeus tip is slightly 

expanded in the area of the lateral serrations, which are relatively few and not prominent. Anastrepha 

suspensa and A. fraterculus differ in having a much shorter aculeus and aculeus tip with more 

prominent lateral serrations and by other characters as well. Anastrepha ludens usually has a pair of 

lateral dark spots on the subcutellum which typically extend ventrally onto the mediotergite. The V 

band is usually not connected to the S band and is faint anteriorly in most specimens (Foote, Blanc 

and Norrbom 1993). 






BsrI: DNC 

HhaI: DNC 

HinfI: 550 

Sau3AI: DNC 

SnaBI: DNC 

SspI: DNC 

Vspl: 550 


HOST RANGE 

Anastrepha ludens has been recorded on hosts from a wide range of families. These include: 

Anacardiaceae, Annonaceae, Caricaceae, Clusiaceae, Ebenaceae, Lauraceae, Lythraceae, 

Myrtaceae, Passifloraceae, Rosaceae, Rubiaceae, Rutaceae and Sapotaceae (for a full list of 

recorded hosts see CABI 2007). 



Annona cherimola cherimoya Mangifera indica mango 

Citrus spp. citrus Prunus persica peach 

165

DISTRIBUTION 

Texas, United States, south through Mexico to Costa Rica (Foote, Blanc and Norrbom 1993). 

REMARKS 

Anastrepha ludens is a well-defined and clearly distinct species, although there is a possibility of a 

separate but nearly indistinguishable form in the extreme southern part of its distribution in Costa Rica 

(UF & FDACS 2009). 

PEST STATUS 

• Exotic 

• High priority pest identified in Citrus IBP 

• Anastrepha ludens is serious pest of Citrus spp. and mangoes 

ATTRACTANT 


FIGURES 

Figure 86. Anastrepha ludens 


166

Figure 87. Anastrepha ludens 


167

7.6.3 Anastrepha obliqua (Macquart) 


Common name: West Indian fruit fly 


Tephritis obliqua 

Anastrepha obliqua 

DIAGNOSIS 


Externally, Anastrepha obliqua quite closely resembles A. fraterculus and A. suspensa, thereby 

presenting problems in their separation. However, a number of characters exist that appear to be 

critical in separating A. obliqua from A. fraterculus. The aculeus is subtly different from those of A. 

fraterculus and A. suspensa, having lateral serrations on more than two-thirds of the tip in contrast to 

those of the other species, where they are limited to the apical two-fifths to three-fifths of the tip. In A. 

obliqua, the tip also is relatively wider at the base of the serrations compared with the width at the 

genital opening. The white medial vitta on the scutum is wider in A. obliqua than in A. suspensa and A. 

fraterculus, and no scutoscutellar black spot or lateral dark marks on the subscutellum are present, 

although the mediotergite usually has a lateral dark stripe (Foote, Blanc and Norrbom 1993). 






BsrI: DNC 

HhaI: DNC 

HinfI: 270, 450 

Sau3AI: 200, 450 

SnaBI: DNC 

SspI: 150, 550 

Vspl: 550 


HOST RANGE 

Anastrepha obliqua has been recorded on hosts from a range of families. These include: 

Anacardiaceae, Ebenaceae, Malpighiaceae, Moraceae, Myrtaceae, Oxalidaceae, Passifloraceae, 

Rosaceae, Rubiaceae, Rutaceae and Sapotaceae (for a full list of recorded hosts see CABI 2007). 



Mangifera indica mango Spondias 

purpurea 

purple mombin 

168

DISTRIBUTION 

Throughout the greater and lesser Antilles, Jamaica, Trinidad, the Rio Grande Valley of Texas, Mexico 

to Panama, Venezuela, Ecuador, and the vicinity of Rio de Janeiro, Brazil (UF & FDACS 2009). 

REMARKS 

Anastrepha obliqua, along with A. fraterculus and A. suspensa, is best recognised by the wing colour 

pattern (Figure 89). It is one of the most widely distributed Anastrepha species, having been recorded 

from Florida (USA), Southern and Central America and the West Indian islands. It is an important pest 

of mangoes, guava, rose apple and Spondias (pers. comm. Drew 2010). 

PEST STATUS 

• Exotic 

• Anastrepha obliqua is one of the most important fruit fly pests of mango in Central and 

Southern America 

ATTRACTANT 

No known record, but can be captured in traps emitting ammonia.. 

FIGURES 

Figure 88. Anastrepha obliqua 


169

Figure 89. Anastrepha obliqua 


170

7.6.4 Anastrepha serpentina (Wiedemann) 


Common name: Sapote fruit fly 


Dacus serpentinus 

Acrotoxa serpentinus 

Anastrepha serpentina 

DIAGNOSIS 


As in Anastrepha ocresia and a few non-U.S. Anastrepha species, the very dark wing markings of A. 

serpentina contrast strongly with the light hyaline areas of the wing. The S band is quite slender and is 

not connected to the proximal area of the V band, the apical arm of which is absent in all specimens. 

Anastrepha serpentina and A. ocresia are the only species of Anastrepha occurring in the United 

States that have a distinct pale yellow to hyaline area in cell r1 immediately posterior to the 

pterostigma, but the former may be distinguished from the latter by the complete absence of the distal 

arm of the V band and the difference in abdominal markings. The scutum of the species is 

characterised by contrasting light and dark markings; the subscutellum and mediotergite are very dark, 

with a lighter brownish or yellowish spot or stripe dorsally (Foote et al. 1993). 






BsrI: DNC 

HhaI: DNC 

HinfI: DNC 

Sau3AI: 200, 530 

SnaBI: DNC 

SspI: DNC 

Vspl: 250, 420 


HOST RANGE 

Anastrepha serpentina has been recorded on hosts from eight families. These include: 

Anacardiaceae, Annonaceae, Clusiaceae, Lauraceae, Myrtaceae, Rosaceae, Rutaceae and 

Sapotaceae (for a full list of recorded hosts see CABI 2007). 



Chrysophyllum cainito cainito Manilkara zapota sapodilla 

Citrus spp. citrus 

171

DISTRIBUTION 

Northern Mexico south to Peru and northern Argentina. Also known from Trinidad & Tobago and 

Curaçao (Norrbom 2003). 

REMARKS 

Anastrepha serpentina is distinguished by its very dark wing patterns (Figure 91. Anastrepha 

serpentina It is most prevalent in Mexico, Southern and Central America, as far south as Brazil. It has 

a wide host range but is not considered to be of significant economic importance (pers. comm. Drew 

2010). 

PEST STATUS 

• Exotic 

• Not considered to be of significant economic importance 

ATTRACTANT 


. 

FIGURES 

Figure 90. Anastrepha serpentina 


172

Figure 91. Anastrepha serpentina 


173

7.6.5 Anastrepha striata Schiner 


Common name: Guava fruit fly 


DIAGNOSIS 


A small to medium-sized species with a “normal” Anastrepha wing pattern, A. striata is one of the few 

species occurring in the United States that has distinct dark scutal markings in addition to darkening 

along the scutoscutellar suture. On the sublateral dark scutal areas, a pair of dense patches of short, 

brownish black setae is present, as well as some hoary pile visible only when viewed from in front, but 

the lateral half of the scutal brown stripe is denuded. Anastrepha striata is the only U.S. species 

having such scutal characters. The aculeus tip is distinctly broad and wedge-shaped with a very blunt 

apex and extremely fine lateral serrations. The size of the hyaline mark at the apex of vein R1 varies 

considerably (Foote et al. 1993). 




See PCR-DNA barcoding (Section ). 

HOST RANGE 

Anastrepha striata has been recorded on hosts from a range of families. These include: 

Anacardiaceae, Annonaceae, Combretaceae, Ebenaceae, Euphorbiaceae, Lauraceae, Myrtaceae, 

Rosaceae, Rutaceae and Sapotaceae (for a full list of recorded hosts see CABI 2007). 



Psidium guajava guava 

DISTRIBUTION 

Southern Texas, Mexico, Central America, south to Peru, Bolivia and Brazil. Also found in Trinidad, 

West Indies (UF & FDACS 2009). 

REMARKS 

Anastrepha striata is a smaller species of Anastrepha and best diagnosed by the distinct dark colour 

markings on the scutum, composed of a U-shaped black pattern. It is present in Mexico, Central 

America and most of Southern America. It is primarily a pest of guava (pers. comm. Drew 2010). 

PEST STATUS 

• Exotic 

ATTRACTANT 


174

FIGURES 

Figure 92. Anastrepha striata 

Carroll et al., Pest fruit flies of the world, http://delta-intkey.com/ffa (as of 22 August 2011) 

175

7.6.6 Anastrepha suspensa (Loew) 


Common name: Caribbean fruit fly 


Trypeta suspensa 

Acrotoxa suspensa 

Trypeta (Acrotoxa) suspensa 

DIAGNOSIS 


Anastrepha suspensa possesses external characters that closely resemble those of A. fraterculus and 

A. obliqua; therefore, the separation of these three species is sometimes difficult. One of the most 

obvious distinguishing marks in A. suspensa is the presence (except in some specimens from 

Jamaica) of a dark spot at the junction of the scutum and scutellum. This spot is sometimes present in 

A. fraterculus but is usually smaller, and it is absent in A. obliqua. The apical part of the S band in A. 

suspensa is relatively wide compared with that in the other two species, and its inner margin is less 

concave. It covers the apex of vein M or ends immediately anterior to it, whereas in the other two 

species it normally ends well anterior to the apex of vein M, or its inner margin is strongly concave. As 

in the identification of other species of Anastrepha, the shape of the aculeus tip is important. In A. 

suspensa, as in A. fracterculus, the serrations occupy no more than three-fifths of the tip, whereas 

those in A. obliqua occupy at least two-thirds; this character is variable and should be used with care 

(Foote et al. 1993). 





HOST RANGE 

Anastrepha suspensa has been recorded on hosts from a wide range of families. These include: 

Anacardiaceae, Annonaceae, Arecaceae, Canellaceae, Caricaceae, Chrysobalanaceae, Clusiaceae, 

Combretaceae, Curcurbitaceae, Ebenaceae, Lauraceae, Lythraceae, Malpighiaceae, Moraceae, 

Myrtaceae, Oxalidaceae, Polygonaceae, Rosaceae, Rutaceae, Salicaceae, Sapindaceae, Sapotaceae 

and Solanaceae (for a full list of recorded hosts see CABI 2007). 

176

Major commercial hosts (CABI 2007; UF & FDACS 2009): 


Annona reticulata bullock's heart Prunus persica peach 

Eugenia uniflora Surinam cherry Psidium guajava guava 

Fortunella margarita oval kumquat Syzygium jambos rose apple 

Manilkara zapota sapodilla Terminalia catappa Singapore almond 

DISTRIBUTION 

Cuba, Jamaica, Hispaniola, Puerto Rico, southern Florida,(United States) (UF & FDACS 2009). 

REMARKS 

Along with Anastrepha obliqua and A. fraterculus, A. suspensa is very difficult to identify. These 

species all have similar wing colour patterns and A. fraterculus is suspected of belonging to a complex 

of closely related species. Generally, A. suspensa possesses a dark spot on the posterocentral area 

of the scutum where it joins the scutellum. A. suspensa is distributed in Florida (USA), the Bahamas 

and the West Indies, has a wide host range and is considered to be of major economic importance 


PEST STATUS 

• Exotic 

• Major economic importance 

ATTRACTANT 

No known record, but can be captured in traps emitting ammonia... 

FIGURES 

Figure 93. Anastrepha suspensa 

Image courtesy of Carroll et al., Pest fruit flies of the world, http://delta-intkey.com/ffa 

177

Figure 94. Anastrepha suspensa 

(as of 22 August 2011) 


178

7.7 Rhagoletis 

7.7.1 Rhagoletis completa Cresson 


Common name: Walnut husk fly 


Rhagoletis suavis completa 

Rhagoletis suavis var. completa 

DIAGNOSIS 


The four transverse wing bands are present and are usually distinctly separated by hyaline areas, 

except in occasional specimens in which the discal and subapical bands are connected posteriorly. In 

the former case, the pattern closely resembles that of R. berberis, but the host relationships of these 

two species are quite different. The thorax and abdomen of R. completa are golden yellow (completely 

black in R. berbeis) and the scutellum is concolorous yellow (black with a distinct yellow spot in R. 

berberis) (Foote et al. 1993). 





HOST RANGE 

Rhagoletis completa has been recorded on hosts from two families, Juglandaceae and Rosaceae (for 

a full list of recorded hosts see CABI 2007). 



Juglans californica California walnut Juglans nigra black walnut 

Juglans hindsii Californian black walnut Juglans regia walnut 

DISTRIBUTION 

Southern and Central USA including Mexico; adventive in Western USA since the 1920s. Also 

established in Southern Europe since the early 1990s (CABI 2007). 

REMARKS 

Rhagoletis completa is an unusual economic tephritid species in that it is a major pest of walnuts, in 

contrast to the soft fleshy fruit hosts of other fruit fly species. It is best diagnosed by the distinctive 

wing colour patterns (Figure 95) and a red-brown thorax. It is widely distributed over Central and 

Western mainland USA (pers. comm. Drew 2010). 

179

PEST STATUS 

• Exotic 

• High priority pest identified in the Nuts IBP 

ATTRACTANT 


FIGURES 

Figure 95. Rhagoletis completa 


180

7.7.2 Rhagoletis fausta (Osten-Sacken) 


Common name: Black cherry fruit fly 


Trypeta (Acidia) fausta 

Trypeta fausta 

Rhagoletis fausta 

Acidia fausta 

DIAGNOSIS 


Rhagoletis fausta is very close to R. striatella in that the posterior apical band in both species arises 

from the subapical band in the vicinity of vein r-m, making an F-shaped pattern in the apical half of the 

wing similar to that in the pomonella group (however, in the latter, note that the subapical band is 

missing and the apical bands are connected to the discal band). In wing pattern alone, R. fausta is 

unique among North American Rhagoletis in combining a very broad connection between the discal 

and subapical bands in cell dm with the presence of both an anterior and posterior apical band, the 

latter arising in much the same location as in R. striatella. In R. striatella, the discal and subapical 

bands are separate or connected only along the posterior wing margin. In many respects, the wing 

pattern of R. fausta resembles that of R. suavis, but R. fausta has both anterior and posterior apical 

bands and an isolated hyaline spot in the distal half of cell cua1. Rhagoletis suavis has a yellowish 

body; that of R. fausta is black and without yellowish bands at the posterior margins of the abdominal 

terga (Foote et al. 1993). 





HOST RANGE 

Rhagoletis fausta has been recorded on hosts the Rosaceae family (for a full list of recorded hosts see 

CABI 2007). 



Prunus avium sweet cherry Prunus cerasus sour cherry 

DISTRIBUTION 

Widespread occurrence in western and eastern North America (United States and Canada) (CABI 

2007). 

181

REMARKS 

Rhagoletis fausta is a dark coloured species with the scutum and abdominal tergites primarily black. It 

also has a unique wing colour pattern (Figure 96). It is widely distributed over mainland USA where it 

infests cherry varieties in the plant genus Prunus (pers. comm. Drew 2010). 

PEST STATUS 

• Exotic 

• High priority pest identified in the Cherry IBP 

• Rhagoletis fausta is an important pest of cherries in North America 

ATTRACTANT 


FIGURES 

Figure 96. Rhagoletis fausta 


182

7.7.3 Rhagoletis indifferens Curran 


Common name: Western cherry fruit fly 


Rhagoletis cingulata 

Rhagoletis cingulata indifferens 

DIAGNOSIS 


Rhagoletis indifferens is similar to R. cingulata in wing pattern but the anterior arm of R. indifferens is 

broken to produce an apical spot in only about 5% of individuals in contrast to R. cingulata, in which 

this spot is much more commonly encountered. In addition, other characters that distinguish R. 

indifferens from R. cingulata are as follows: 

Rhagoletis indifferens: 

A. Apical yellow shading on posterior margin of tergite 5 of male lacking. 

B. Black shading always present on posterior surface of fore coxa 

C. Epandrium dark-coloured 

Rhagoletis cingulata: 

A. Apical yellow shading on posterior margin of tergite 5 of male present 

B. Fore coxae concolorous yellow 

C. Epandrium light-coloured 

Most individuals of R. indifferens may be distinguished from those of R. chionanthi and R. osmanthi by 

the differences in geographical distribution and hosts and by the generally smaller size and lesser 

development of the wing bands. (Foote et al. 1993). 





HOST RANGE 

Rhagoletis indifferens has been recorded on hosts the Rosaceae family (for a full list of recorded hosts 

see CABI 2007). 



Prunus avium sweet cherry 

183

DISTRIBUTION 

Rhagoletis indifferens is a western North American species (Canada and United States). Adventive 

populations have been found in southern Switzerland since the early 1990s (CABI 2007). 

REMARKS 

Rhagoletis indifferens may not be a distinct species but a colour variety of Rhagoletis cingulata. It is 

distributed primarily over western regions of mainland USA where it infests wild and cultivated cherries 

of the plant genus Prunus (pers. comm. Drew 2010). 

PEST STATUS 

• Exotic 

• High priority pest identified in the Cherry IBP 

• Rhagoletis indifferens is an important pest of cherries in North America 

ATTRACTANT 


FIGURES 

Figure 97. Rhagoletis indifferens 


184

7.7.4 Rhagoletis pomonella (Walsh) 


Common name: Apple maggot 


Trypeta pomonella 

Trypeta (Rhagoletis) pomonella 

DIAGNOSIS 


Rhagoletis pomonella, together with R. zephyria, R. mendax and R. cornivora are among the most 

readily recognised species of Rhagoletis by virture of their wing pattern, which consists of a slightly 

oblique discal band to which the anterior and posterior apical bands are connected, forming a 

characteristic F-shaped pattern in the apical half of the wing. The absence of the subapical band 

distinguishes the species of the pomonella group from all other species of Rhagoletis. Rhagoletis 

striatella, which also has an F-shaped apical wing pattern, is distinguished from R. pomonella by the 

colour pattern of the scutellum and the additional characters given in the key to species. Rhagoletis 

pomonella is separable from the other three species of the pomonella group by the presence in most 

specimens of heavy black shading on the posterior surface of the fore femur, and, in specimens from 

the northern part of its range, by a generally larger body size and by the longer aculeus (0.90- 

1.49mm). In the southern part of its range, specimens of R. pomonella generally are smaller than in 

the north. For that reason and because of a consequently shorter aculeus, females are not separable 

from those of R. mendax and R. cornivora by the use of morphological characters. Mexican specimens 

of R. pomonella resemble those that occur in the United States and Canada but generally are larger 

and possess a light spot near the base of the apical wing band (Foote, Blanc and Norrbom 1993). 





HOST RANGE 

Rhagoletis pomonella has been recorded on hosts from the Rosaceae family (for a full list of recorded 

hosts see CABI 2007). 



Malus domestica apple 

DISTRIBUTION 

Canada, United States and Mexico (Carroll et al. 2002). 

REMARKS 

Rhagoletis pomonella possesses primarily a black scutum and abdomen and a distinctive wing colour 

pattern (Figure 98). It has been the subject of extensive taxonomic, ecological and pest management 

185

esearch in the USA and is considered the major economic pest species within the genus Rhagoletis. 

It is a major pest of cultivated apples. It is distributed over the central and north-eastern regions of 

mainland USA and extreme southern Canada. In 1979 it was introduced into the western coastline of 

the USA and is now widespread in that region (pers. comm. Drew 2010). 

PEST STATUS 

• Exotic 

• High priority pest identified in the Apple and Pear, and Cherry IBPs 

• Rhagoletis pomonella, which primarily attacks apples, is the most serious fruit fly pest in North 

America 

ATTRACTANT 

No known record, but can be captured in traps emitting ammonia.. 

FIGURES 

Figure 98. Rhagoletis pomonella 


186

8 Diagnostic resources 

8.1 Key contacts and facilities 

Contact Facility 

Prof. RAI (Dick) Drew 

D.Drew@griffith.edu.au 

Dr. David Yeates 

Curator of Diptera 

David.Yeates@csiro.au 

Dr. Paul De Barro 

Paul.DeBarro@csiro.au 

Mr. Peter S. Gillespie 

Insect Collection Manager 

Peter.S.Gillespie@dpi.nsw.gov.au 

Mr. Bernie Dominiak 

Bernie.Dominiak@dpi.nsw.gov.au 

Dr. Deborah Hailstones 

D.Hailstones@crcplantbiosecurity.com.au 

Assoc. Prof. Phillip Taylor 

Phil@Galliform.bhs.mq.edu.au 

Dr. Anthony (Tony) R Clarke 

Senior Lecturer in Ecology 

A.Clarke@qut.edu.au 

Ms. Jane Royer 

Entomologist 

Jane.Royer@deedi.qld.gov.au 

International Centre for Management of Pest Fruit 

Flies 


170 Kessels Road, Nathan, Qld 4111, Australia 

Phone: (07) 3735 3696 

Fax: (07) 3735 3697 

CSIRO Entomology 

GPO Box 1700, Canberra, ACT 2601 

Phone: (02) 6246 4001 

Fax: (02) 6246 4177 

Orange Agricultural Institute 

Industry and Investment NSW 

1447 Forest Road, Orange, NSW 2800 

Phone: (02) 6391 3986 

Fax: (02) 6391 3899 

Elizabeth Macarthur Agricultural Institute 

Woodbridge Road, Menangle, NSW 2568 

Phone: (02) 4640 6333 

Fax: (02) 4640 6300 

Behavioural Biology Research Group 

Department of Brain, Behaviour & Evolution 

Macquarie University, Sydney, NSW 2109 

Phone: (02) 9850 1311 

Fax: (02) 9850 4299 

Faculty of Science and Technology 

Queensland University of Technology 

GPO Box 2434, Brisbane, Qld 4001, Australia 

Phone: (07) 3138 5023 

Fax: (07) 3138 1535 

Cairns District Office 

Queensland Department of Employment, Economic 

Development & Innovation 

21 Redden Street, Cairns, Qld 4870 

Phone: (07) 4044 1640 

Fax: (07) 4035 5474 

187


Dr. Anthony Rice 

Senior Entomologist 

Anthony.Rice@aqis.gov.au 

Mr. James Walker 

James.Walker@aqis.gov.au 

Ms. Sally Cowan 

Sally.Cowan@aqis.gov.au 

Mr. Glenn Bellis 

Entomologist 

Glenn.Bellis@aqis.gov.au 

Dr. Jan Bart Rossel 

Senior Plant Scientist 

Bart.Rossel@aqis.gov.au 

Dr. Gary Kong 

Principal Plant Pathologist 

Gary.Kong@dpi.qld.gov.au 

Dr. Mali Malipatil 

Principal Research Scientist 

Mallik.Malipatil@dpi.vic.gov.au 

Ms. Linda Semeraro 

Entomologist 

Linda.Semeraro@dpi.vic.gov.au 

Dr Mark Blacket 

Entomologist 

Mark.Blacket@dpi.vic.gov.au 

Ms. Jane Moran 

Deputy Research Director, Bioprotection 

Jane.Moran@dpi.vic.gov.au 

Dr. Darryl Hardie 

Entomologist 

DHardie@agric.wa.gov.au 

AQIS Cairns 

Airport Business Park, Cairns Airport 

Building 114, Catalina Crescent, Cairns, QLD 4870 

Phone: (07) 4030 7800 

Fax: (07) 4030 7843 

AQIS Darwin 

1 Pederson Road, Marrara, NT 0812 

Phone: (08) 8920 7000 

Fax: (08) 8920 7011 

AQIS 

18 Marcus Clarke St, Canberra, ACT 2601 

Phone: (02) 6272 3933 

Toowoomba DPI&F 

Queensland Department of Employment, Economic 

Development & Innovation 

PO Box 102, TOOWOOMBA, QLD 4350 

Phone: (07) 4688 1200 

Fax: (07) 4688 1199 

Department of Primary Industries Victoria - Knoxfield 

Centre 

PB 15, Ferntree Gully Delivery Centre, Vic 3156 

Laboratory : 621 Burwood Highway, Knoxfield. 

Reference Collection: Victorian Agricultural Insect 

Collection. 

Phone: (03) 9210 9338 

Fax: (03) 9800 3521 

Entomology Branch 

Department of Agriculture and Food WA 

Locked Bag 4, Bentley Delivery Centre, WA 6983 

Phone: (08) 9368 3721 

Fax: (08) 9474 2405 

188


Mr. Andras Szito 

Entomologist 

ASzito@agric.wa.gov.au 

Mr. Mark Adams 

mark.adams@sa.gov.au 

Dr. Karen Armstrong 

Karen.Armstrong@lincoln.ac.nz 

Dr. Andrew Mitchell 

Research Leader Biotechnology 

Andrew.Mitchell@dpi.nsw.gov.au 

Dr. Brian Thistleton 

Principal Entomologist, Plant Industries 

Brian.Thistleton@nt.gov.au 

Science Centre 

South Australian Museum 

Morgan Thomas Lane, Adelaide, SA 5000 

Phone: (08) 8207 7305 

Fax: (08) 8207 7222 

Bio-Protection Research Centre 

PO Box 84, Lincoln University, Canterbury 7647, New 

Zealand 

Phone: +64 3 325 3696 

Fax: +64 3 325 3864 

Wagga Wagga Agricultural Institute 

Industry and Investment NSW 

Pine Gully Road, Wagga Wagga, NSW 2650 

Phone: (02) 6938 1999 

Fax: (02) 6938 1809 

Department of Resources 

GPO Box 3000, Darwin NT 0801 

Phone: (08) 8999 2257 

Fax: (08) 8999 2312 

For international fruit fly authorities, see www.sel.barc.usda.gov/Diptera/tephriti/TephWork.htm 

8.2 Reference collections 

Collection Location 

Victorian Agricultural Insect Collection, DPI Vic. AgriBio Building, DPI Bundoora Campus, Victoria. 

Queensland Primary Industries Insect 

Collection, DEEDI. 

Biosecurity Queensland, DEEDI Ecosciences Precinct, 

GPO Box 46, Brisbane QLD 4001, Australia. 

DEEDI Biosecurity Insect Collection. 21 Redden Street, Cairns QLD 4870, Australia. 

NAQS Insect Collection. Airport Business Park, Cairns Airport Building 114, 

Catalina Cresent, Cairns QLD 4870, Australia. 

The Northern Territory Economic Insect 

Reference Collection. 

Museum and Art Gallery of the Northern 

Territory, NRETAS. 

Department of Resources, Primary Industry, Berrimah 

Farm, Makagon Road, Berrimah NT 0828, Australia. 

Conacher Street, Fannie Bay, Darwin NT 0820, 

Australia. 

189

8.3 Printed and electronic resources 

8.3.1 Morphological keys 

In practice in Australia the two paper keys that are most commonly used are: 

• Drew, R.A.I. (1989) The tropical fruit flies (Diptera: Tephritidae: Dacinae) of the Australian and 

Oceanian regions. Memoirs of the Queensland Museum. 26: 1-521. 

• Drew, R.A.I. and Hancock, D.L. (1994) The Bactrocera dorsalis complex of fruit flies (Diptera: 

Tephritidae: Dacinae) in Asia. Bulletin of Entomological Research. Supplementary Series 2: 1- 

68. 

Other paper-based keys include: 

• Drew, R.A.I. and Raghu, S. (2002) The fruit fly fauna (Diptera: Tephritidae: Dacinae) of the 

rainforest habitat of the Western Ghats, India. Raffles Bulletin of Zoology. 50, 327-352. 

• Drew, R.A.I. and Hancock, D.L. (1994) Revision of the tropical fruit flies (Diptera: Tephritidae: 

Dacinae) of South East Asia. I. Ichneumonopsis Hardy and Monacrostichus Bezzi. 

Invertebrate Taxonomy, 8, 829-838. 

• Drew, R.A.I., Hancock, D.L. and White, I.M. (1998) Revision of the tropical fruit flies (Diptera: 

Tephritidae: Dacinae) of South-east Asia. II. Dacus Fabricius. Invertebrate Taxonomy, 12, 

567-654. 

• Drew, R.A.I. and Romig, M.C. (2001) The fruit fly fauna (Diptera: Tephritidae: Dacinae) of 

Bougainville, the Solomon Islands and Vanuatu. Australian Journal of Entomology, 40, 113- 

150. 

• Drew, R.A.I., Hooper, G.H.S. and Bateman, M.A. (1982) Economic fruit flies of the South 

Pacific region. Queensland Department of Primary Industries, Brisbane, Queensland. 139 pp. 

• White, I.M. and Elson-Harris, M.M. (1992) Fruit Flies of Economic Significance: Their 

Identification and Bionomics. CAB International. Oxon, UK. 601 p. 

• Rohani, I. (1987) Identification of larvae of common fruit fly pest species in West Malaysia. 

Journal of Plant Protection in the Tropics, 4 (2), 135-137. 

• Hardy, E.D. (1986) Fruit flies of the subtribe Acanthonevrina of Indonesia, New Guinea, and 

the Bismarck and Solomon Islands (Diptera: Tephritidae: Trypetinae: Acanthonevrina). Pacific 

Insect Monographs, No. 42. Honolulu, Hawaii. 191 p. 

• Hardy, E.D. (1974) The fruit flies of the Philippines (Diptera - Tephritidae). Pacific Insect 

Monographs, No. 32. Honolulu, Hawaii. 266 p. 

• Significant information on the larvae of many Australian fruit flies, including ones not of 

economic importance but that might turn up during sampling, was given in the PhD thesis of 

Dr Marlene Elson-Harris lodged at the University of Queensland. 

Electronic keys available include: 

• White, I.M. and Hancock, D.L. (2003) Fauna Malesiana [electronic key to fruit flies]. ISBN 

9075000359. 

• White, I.M. and Hancock, D.L. (1997) Indo-Australasian Dacini Fruit Flies (CABIKEY) 

International Institute of Entomology, London. CD-ROM. 

• Lawson, A.E., McGuire, D.J., Yeates, D.K., Drew, R.A.I. and Clarke, A.R. (2003) Dorsalis: an 

interactive identification tool to fruit flies of the Bactrocera dorsalis complex. Griffith University. 

Brisbane, Australia. [CD-ROM] [Out of print] 

190

• An interactive key is also available on the Fruit Flies of the World website: http://deltaintkey.com/ffa 

8.3.2 Electronic resources 

• Tephritid Barcoding Initiative (TBI): www.barcodeoflife.org. The TBI aims to barcode 

10,000 specimens representing 2,000 species of fruit flies, including all taxa (about 350 

species) of major and minor economic importance. 

• The Diptera Site: www.sel.barc.usda.gov/Diptera/tephriti/tephriti.htm. Contains a large 

amount of biological and other information about fruit flies. 

• Pest Fruit Flies of the World: http://delta-intkey.com/ffa. Contains comprehensive 

information and keys on fruit flies of all regions. 

• ANIC Anatomical atlas of flies: www.csiro.au/resources/ps252.html. Great for illustrations 

of every feature of acalyptrate flies. 

• On the fly: interactive atlas and key to Australian fly families: 

www.csiro.au/resources/ps236.html. 

• Australian Pest and Diseases Image Library (PaDIL): www.padil.gov.au. Contains species 

information as well as photos for a number of fruit fly species (endemic and exotic). 

• NSW government fruit fly resource: 

www.agric.nsw.gov.au/Hort/ascu/fruitfly/fflyinde.htm. List of fruit fly species found in New 

South Wales or believed to be present there, with links to summary information on each and 

key. 

• International Centre for Management of Pest Fruit Flies (Griffith University and 

Malaysia): http://www.icmpff.org 

• South Pacific fruit fly website (Pacifly): http://www.pacifly.org. Contains profiles of all 

species found in the South Pacific. 

• Featured Creatures: http://entomology.ifas.ufl.edu/creatures/index.htm. Contains profiles 

for a limited number of fruit fly species. 

• The Australian Plant Pest Database (APPD): http://pha.vpac.org. A national, online 

database of pests and diseases of Australia's economically important plants. 

191

8.4 Supplier details 

Supplier Address Contact details 

Applied Biosystems 

(for PCR) 

1270 Ferntree Gully Road 

Scoresby, VIC 3179 

Astral Scientific PO Box 232 

Gymea, NSW 2227 

Bio-Rad Laboratories Pty. Ltd. Level 5, 446 Victoria Road 

GENESEARCH 

(agents for New England 

Biolabs) 

Gladesville, NSW 2111 

14 Technology Drive 

Arundel, QLD 4214 

Interpath services 1/46 Sheehan Rd 

Heidelberg West, VIC 3081 

Invitrogen 

(for primer synthesis) 

PO Box 4296 

Mulgrave, VIC 3170 

Mirella Research Pty. Ltd. PO Box 365 

Brunswick, VIC 3056 

Promega Corporation 

(for Molecular weight marker) 

Qiagen Pty Ltd 

(for DNA extraction) 

Roche Diagnostics Australia 

Pty. Ltd. 

Sigma-Aldrich Pty. Ltd. 

(for chemicals) 

PO Box 168 

Annandale, NSW 2038 

PO Box 25 

Clifton Hill, VIC 3068 

31 Victoria Avenue 

Castle Hill, NSW 2154 

PO Box 970 

Castle Hill, NSW 1765 

Ph: (03) 9212 8500 

Fax: (03) 9212 8502 

www.appliedbiosystems.com.au 

Ph: 1800 221 280 

Fax: (02) 9540 2051 

Ph: (02) 9914 2800 or 1800 224 

354 

Ph: 1800 074 278 or (07) 5594 

0562 

www.genesearch.com.au 

Ph: (03) 9457 6277 or 1800 626 

369 

Fax: (03) 9458 4010 

Ph: 1800 331 627 

Fax: (03) 9562 7773 

www.invitrogen.com 

Ph: (03) 9388 1088 or 1800 640 

444 

Fax: (03) 9388 0456 

Ph: (02) 9565 1100 

Fax: (02) 9550 4454 

www.promega.com 

Ph: (03) 9489 3666 

Fax: (03) 9489 3888 

www.qiagen.com 

Ph: (02) 9899 7999 

Fax: (02) 9634 2949 

Ph: 1800 800 097 

Fax: 1800 800 096 

www.sigmaaldrich.com 

192

9 References 

Allwood, A.J., Chinajariyawong, A., Drew, R.A.I., Hamacek, E.L. and Hancock, D.L. (1999). Host plant 

records for fruit flies (Diptera: Tephritidae) in South East Asia. Raffles Bull. Zool. Supplement No. 7: 1- 

92. 

Armstrong K.F. and Cameron,C.M., 1998. Molecular Kit for Species Identification Fruit Flies 

(Tephritidae), Lincoln University 

Armstrong, K.F. and Ball, S.L. (2005). DNA barcodes for biosecurity: invasive species identification. 

Philos. Trans. R. Soc. Lond., B, Biol. Sci. 360: 1813-1823 

Blacket M.J., Semeraro L., and Malipatil M.B. (2012). Barcoding Queensland Fruit Flies (Bactrocera 

tryoni): impediments and improvements. Mol. Ecol. Resour. (In press). 

CABI (2007) Crop Protection Compendium, 2007 Edition. CAB International, Wallingford, UK. Online 

version: http://www.cabi.org/compendia/cpc/ [accessed May 2010] 

Cameron, E.C., Sved, J.A., and Gilchrist, A.S. (2010). Pest fruit fly (Diptera: Tephritidae) in 

northwestern Australia: one species or two? Bulletin of Entomological Research. 100(2):197-206. 

Carroll, L.E., I.M. White, A. Freidberg, A.L. Norrbom, M.J. Dallwitz, and F.C. Thompson. (2002 

onwards). Pest fruit flies of the world. Version: 8th December 2006. http://delta-intkey.com [accessed 

May 2010]. 

Clarke, A.R., Armstrong, K.F., Carmichael, A.E., Milne, J.R., Raghu, S., Roderick, G.K. and Yeates, 

D.K. (2005) Invasive phytophagous pests arising through a recent tropical evolutionary radiation: The 

Bactrocera dorsalis complex of fruit flies. Annual Review of Entomology. 50: 293-319. 

Department of Agriculture Western Australia. Exotic Fruit Fly 

http://agspsrv34.agric.wa.gov.au/ento/Surveillance/Fruit%20fly.html#The%20Lynfield%20lure%20trap [accessed 

January 2011]. 

Dominiak, B. C. and Daniels, D. (2011) Review of the past and present distribution of Mediterranean 

fruit fly (Ceratitis capitata Wiedemann) and Queensland fruit fly (Bactrocera tryoni Froggatt) in 

Australia. Australian Journal of Entomology. (In press) 

Dominiak, B.C., Gilmour, A.R., Kerruish, B., and Whitehead, D. (2003) Detecting low populations of 

Queensland fruit fly Bactrocera tryoni (Froggatt) with McPhail and Lynefield traps. General and 

Applied Entomology Vol.32 49-54. 

Dominiak, B.C., Kerruish, B., Barchia, I., Pradhan, U., Gilchrist, A.S., and Nicol, H.I. (2011) The 

influence of mixtures of parapheromone lures on trapping of fruit fly in New South Wales, Australia. 

Plant Protection Quarterly Vol.26(4) 136-140. 

Dominiak, B.C. and Nicol, H.I. (2010) Field performance of McPhail and Lynefield traps for monitoring 

male and female sterile Bactrocera tryoni (Froggatt) and wild Dacus newmani (Perkins). Pest 

Management Science Vol.66 741-744. 

Drew, R.A.I. (1989) The tropical fruit flies (Diptera: Tephritidae: Dacinae) of the Australian and 

Oceanian regions. Memoirs of the Queensland Museum. 26: 1-521. 

Drew, R.A.I. and Hancock, D.L. (1994) The Bactrocera dorsalis complex of fruit flies (Diptera: 

Tephritidae: Dacinae) in Asia. Bulletin of Entomological Research. Supplementary Series 2: 1-68. 

Drew, R.A.I. and Lambert, D.M. (1986) On the specific status of Dacus aquilonis and Dacus tryoni 

Diptera Tephritidae. Annals of the Entomological Society of America. 79(6): 870-878. 

Drew, R.A.I., G.H.S. Hooper and M.A. Bateman. (1982). Economic Fruit Flies of the South Pacific 

Region. Queensland Department of Primary Industries. 

193

Fay, H.A.C. (2011). A highly effective and selective male lure for Bactrocera jarvisi (Tryon) (Diptera: 

Tephritidae). Australian Journal of Entomology (In press) 

Flath, R.A., Cunningham, R.T., Liquido, N.J. and McGovern, T.P. (1994). Alpha-Ionol as Attractant for 

Trapping Bactrocera latifrons (Diptera: Tephritidae). Journal of Economic Entomology 87(6):1470- 

1476. 

Floyd, R., Lima, J., deWaard, J., Humble, L., and Hanner, R. (2010). Common goals: policy 

implications of DNA barcoding as a protocol for identification of arthropod pests. Biological Invasions. 

12: 2947-2954. 

Folmer, O., Black, M., Hoeh, W., Lutz, R. and Vrijenhoek, R. (1994). DNA primers for amplification of 

mitochondrial cytochrome c oxidase subunit I from diverse metazoan invertebrates. Mol. Mar. Biol. 

Biotechnol. 3: 294-299. 

Foote, R.H., Blanc, F.L. and Norrbom, A.L. (1993) Handbook of the Fruit Flies (Diptera: Tephritidae) of 

America North of Mexico. Comstock, Ithaca, N.Y. 

Gilbert, M.T.P., Moore, W., Melchior, L., and Worobey, M. (2007). DNA extraction from dry museum 

beetles without conferring external morphological damage. PLoS ONE 2: e272. 

Hancock, D.L., Hamacek, E.L., Lloyd, A.C. and Elson-Harris, M.M. (2000). The distribution and host 

plants of fruit flies (Diptera: Tephritidae) in Australia. Queensland Department of Primary Industry. 

Information series Q199067. Brisbane, Queensland. 75pp. 

Lawson, A.E., McGuire, D.J., Yeates, D.K., Drew, R.A.I. and Clarke, A.R. (2003). Dorsalis: an 

interactive identification tool to fruit flies of the Bactrocera dorsalis complex. Griffith University. 

Brisbane, Australia. [CD-ROM] 

Manchenko, G.P. (1994). Handbook of detection of enzymes on electrophoretic gels. CRC Press, 

Boca Raton, Florida. 

McKenzie, C., Gillispie, P. and Hailstones, D. (2004). Draft molecular diagnostic standard for fruit flies 

of economic significance to Australia. Plant Health Australia and NSW Department of Primary 

Industries. 

McKenzie, L., Dransfield, L., Driver, F. and Curran, J. (1999). Molecular protocols for species 

identification of tephritid fruit flies. Report to AQIS. CSIRO, Canberra. 

Metcalf, R.L., Mitchell, W.C., and Metcalf, E.R. (1983). Olfactory receptors in the melon fly Dacus 

cucurbitae and the oriental fruit fly Dacus dorsalis. Proc. Natl. Acad. Sci. USA. 80: 3143-3147. 

Norrbom, A.L. (2003). The Diptera site. Systematic Entomology Laboratory, ARS, USDA and 

Department of Entomology, NMNH, SI. www.sel.barc.usda.gov/diptera/tephriti/tephriti.htm [accessed May 

2010]. 

Osborne, R., Meats, A., Frommer, M., Sved, J.A., Drew, R.A.I., and Robson, M.K. (1997) Australian 

Distribution of 17 Species of Fruit Flies (Diptera: Tephritidae) Caught in Cue Lure Traps in February 

1994. Australian Journal of Entomology 36: 45-50. 

PaDIL (2007). Pest and disease image library. An Australian Government initiative. www.PaDIL.gov.au 

[accessed May 2010]. 

Queensland Department of Primary Industries and Fisheries (2002). OP-03: Fruit fly identification 

guidelines. Operational Procedures. August, 2002. 

Richardson, B. J., Baverstock, P. R., and Adams, M. (1986). Allozyme electrophoresis. A handbook for 

animal systematics and population studies. Academic Press, Sydney, Australia. 

Secretariat of the Pacific Community (2006) Pacific Fruit Fly Web. www.spc.int/pacifly [accessed May 

2010] 

194

Semeraro,L. and Malipatil,M.B., (2005), Molecular diagnostic test for Queensland fruit fly larvae 

(Bactrocera tryoni Froggatt). 

Smith, E.S.C. and Chin D. (1987). Current fruit fly research in the Northern Territory. Proceedings of 

the 4th Workshop in Tropical Entomology. Darwin, NT 10-15 May 1987, pp. 128-135. 

Smith, E.S.C., Chin, D., Allwood, A.J., and Collins, S.G. (1988) A revised host list of fruit flies (Diptera: 

Tephritidae) from the Northern Territory of Australia. Queensland Journal of Agricultural and Animal 

Sciences. 45(1): 19-28. 

Tsuruta, K., White, I.M., Bandara, H.M.J., Rajapakse, H., Sundaraperuma, S.A.H., Kahawatta, 

S.B.M.U.C., and Rajapakse, G.B.J.P. (1997) A preliminary notes on the host plants of fruit flies of the 

tribe Dacini (Diptera: Tephritidae) in Sri Lanka. Esakia. 37: 149-160. 

White, I.M. and Elson-Harris, M.M. (1992). Fruit Flies of Economic Significance: Their Identification 

and Bionomics. CAB International. Oxon, UK. 601 p. 

University of Florida and the Florida Department of Agriculture and Consumer Services (2009) 

Featured Creatures. http://entomology.ifas.ufl.edu/creatures/index.htm [accessed May 2010]. 

195

10 Appendices 

The papers have been reproduced with permission. 

196

APPENDIX 1

Review of the outbreak threshold for Queensland 

fruit fly (Bactrocera tryoni Froggatt) 

Bernard C. DominiakA , David DanielsB and Richard MapsonC A Department of Primary Industry NSW, Locked Bag 21, Orange, New South 

Wales 2800, Australia and the Department of Biological Sciences, Macquarie 

University, New South Wales 2109, Australia. 

B Department of Agriculture, Fisheries and Forestry, PO Box 858, Canberra, 

ACT 2601, Australia. 

C Department of Primary Industries Victoria, 621 Burwood Highway, 

Knoxfield, Victoria 3180, Australia. 

Abstract 

Fruit flies cause losses in horticultural 

produce across the world and are a major 

quarantine concern for most countries. 

Queensland fruit fly (Qfly) is a native to 

Australia and is also present in a small 

number of Pacific Island countries. The 

detection of Qfly in recognized pest 

free areas triggers quarantine restrictions 

from domestic and international 

markets. In Australia, the detection of 

five male flies has been taken to indicate 

an outbreak (i.e. unacceptable risk). 

Matching the domestic standard, many 

countries have accepted the 5-fly limit as 

a quarantine threshold. But some other 

countries have set the detection of two 

male flies, or even a single fly, as the 

threshold for an outbreak. This different 

standard creates an administrative complexity 

for exporters and trade regulators. 

In this paper, we review the published 

science covering the impediments to pest 

establishment. Outbreak data from Victoria 

and New South Wales during 2007 

and 2009 are reviewed in relation to the 

2-fly and 5-fly thresholds. Large volumes 

of fruit have been traded within Australia 

and internationally based on the 5-fly 

threshold without incident and there is 

no evidence that the 2-fly threshold is 

more appropriate. While Qfly is recognized 

as being capable of longer distance 

dispersal than some other fruit fly species, 

it is also recognized as a poor colonizer. 

The 5-fly threshold is proposed as 

the most appropriate threshold for imposition 

of quarantine restrictions and 

is recommended as a universal standard 

for harmonization of quarantine regulations. 

Introduction 

There are about 4500 species of fruit flies 

worldwide. In the Pacific area alone, there 

are 350 species of which at least 25 species 

are regarded as being of major economic 

importance (Allwood 2000). The genus 

Bactrocera contains over 400 species, distributed 

primarily though the Asia-Pacific 

area including Australia (Drew 1974). 

Tephritid fruit flies cause direct losses to 

many fresh fruit and some vegetable industries, 

resulting in adverse impacts on 

trade and economies of many countries 

(Li et al. 2010, Stephenson et al. 2003). 

With the increasing globalization of trade 

(Stanaway et al. 2001, Plant Health Australia 

2010), fruit flies pose a major quarantine 

concern that is currently monitored 

through regional surveillance programs 

(International Atomic Energy Agency 

2003, Stephenson et al. 2003, Oliver 2007). 

The Queensland fruit fly Bactrocera 

tryoni (Froggatt) (Diptera: Tephritidae) 

(Qfly) is a major fruit fly pest of Australian 

horticulture, attacking most fruit and 

many vegetable crops (e.g. stone fruit, citrus, 

coffee, tomato, capsicum, pome fruit) 

(Bateman 1991, Anon. 1996, Hancock et al. 

2000). Qfly is an Australian native and is 

currently only found in Australia and on 

some Pacific islands (Drew 1989, White 

and Elson-Harris 1992). Given its pest status 

within Australia, Qfly is also a significant 

quarantine concern for many trading 

partners. Markets trading in commodities 

that may be subject to Qfly infestation 

require assurance of reliable monitoring 

grids, evidence-based outbreak thresholds 

and appropriate quarantine measures 

(Bateman 1991, Anon. 1996, Clarke et al. 

2011). 

In the early 1990s, Bateman (1991) reviewed 

existing domestic trade conditions 

and recommended a uniform agreement 

among the Australian states for the management 

of and trade in Qfly host commodities. 

In response, the Code of Practice 

for the Management for Queensland 

Fruit Fly (Anon. 1996) was published, with 

particular emphasis on managing the Tri- 

State Fruit Fly Exclusion Zone (FFEZ) so 

that fruit could be traded domestically 

with increased efficiency. The FFEZ production 

area is managed as a pest free 

area and is recognized by all Australian 

states as being free from economic fruit 

flies. Strict quarantine measures are in 

place to prevent entry of fruit flies and any 

incursions invoke a rapid and thorough 

Plant Protection Quarterly Vol.26(4) 2011 141 

eradication response. Within the FFEZ, 

four separate pest free areas have been 

established to facilitate trade into international 

markets. These include the Riverina 

area of New South Wales, the Sunraysia 

region of Victoria/New South Wales, the 

Riverland area of South Australia, and the 

Shepparton Irrigation Region of Victoria. 

Under some circumstances, Qfly do enter 

the FFEZ and are detected in monitoring 

traps (Dominiak et al. 2003a, Dominiak 

and Coombes 2009). Single-fly detections 

are almost always isolated incursions 

that do not indicate breeding populations 

(Meats et al. 2003). 

For domestic trade (Anon. 1996), an 

outbreak is declared following one (or 

more) of three thresholds. These thresholds 

are the detection of: 

(1) five male flies within 1 km within 14 

days, or 

(2) one mated female, or 

(3) one or more larvae in fruit grown in the 

area. 

The quarantine distance around any outbreak 

is 15 km. This domestic trade agreement 

(Anon. 1996) was broadly adopted 

in principle by 19 countries as the basis 

of international trade. However some 

key components of this agreement, such 

as the outbreak threshold, have not been 

accepted by some importing countries. 

In 1996, the outbreak threshold varied 

from 1, 2 and 5 male flies for 1, 14, and 

3 countries respectively (Robert McGahy 

personal communication). The threshold 

of two male flies and five flies (hereafter 

referred to as 2-fly and 5-fly thresholds) 

are the most commonly used quarantine 

thresholds. The 2-fly threshold is based 

on detections within 400 m while the 5-fly 

threshold is based on detections within 

1 km. By 2009, with increased international 

acceptance of the 5-fly threshold, 

this position had changed with 1, 11 and 9 

countries accepting 1, 2 and 5 male flies respectively 

as outbreak thresholds (David 

Daniels personal communication). These 

different outbreak thresholds lack a robust 

scientific basis and create complex administration 

procedures for trade regulators. 

An agreed evidence-based Qfly outbreak 

threshold would harmonize market requirements 

and thereby facilitate domestic 

and international trade (Clarke et 

al. 2011). A universal outbreak threshold 

would have major implications for trade, 

quarantine and the minimization of pesticides 

in the environment as part of eradication 

programs (cover and bait sprays). 

There is a geometric expansion of areas 

requiring disinfestation unnecessarily by 

each kilometre of quarantine radius for 

outbreaks triggered by a low threshold 

(Clarke et al. 2011). 

The purpose of this paper is to review 

the data from February 2007 to April 2009 

for 2-fly and 5-fly thresholds for fruit fly 

outbreaks in Victoria and New South

142 Plant Protection Quarterly Vol.26(4) 2011 

Wales, and to examine the published scientific 

evidence since 1996 regarding incursions, 

survival, breeding populations 

and the resultant outbreak thresholds. 

This review will focus only on male flies 

as most outbreaks are triggered by the detection 

of male flies. 

Impediments to pest establishment 

Founding propagules 

It has been shown that the introduction 

of fruit flies into pest free areas is most 

often the result of illegal transportation 

into and the inappropriate disposal of infested 

host material within the pest free 

area (Bateman 1991, Dominiak et al. 2000, 

Dominiak and Coombes 2009). This indicates 

that relatively small parcels of fruit 

flies are the source of most Qfly detections. 

Qfly dispersal from these points of 

introduction is limited by lifespan and the 

ability to find food to sustain the effort of 

longer or frequent short flights, survive 

adverse weather and avoid predation 

(Meats and Smallridge 2007, Meats and 

Edgerton 2008, Gilchrist and Meats 2011, 

Weldon and Taylor 2011). Immature fruit 

flies disperse for about two weeks in random 

directions and do not travel in pairs 

(Fletcher 1974a). Following the introduction 

of small numbers of Qfly into fruit fly 

free areas, the chances of a sexually mature 

male and female occurring in the same 

tree or group of trees after many days of 

dispersal is extremely low (Fletcher 1974a, 

Bateman 1977, Meats 1998, Weldon 2003, 

2007, Weldon and Meats 2010). Following 

the introduction of propagules of infested 

fruit into fruit fly free areas, Meats (1998) 

and Meats et al. (2003) proposed that flies 

disperse into a mate-free void and self extinguish, 

as it becomes increasingly unlikely 

that they will participate in mating 

and will therefore not establish a breeding 

population. 

Nutrition 

Nutrition is key for Qfly survival, dispersal, 

reproduction and establishment 

of new populations. Wild flies must find 

sugar, minerals, water and protein from 

products such as bird faeces, honeydew 

and fruit juice (Bateman 1972, Drew et al. 

1984, Dalby-Ball and Meats 2000). In dry 

environments, these products are difficult 

to find. The average lifespan of Qfly without 

food and water is approximately 45 

hours (Weldon and Taylor 2010, Dominiak 

unpublished). Qfly require a balanced 

diet, as diets with too much or too little 

protein and carbohydrate result in adverse 

effects on either longevity or reproduction 

(Prabhu et al. 2008, Fanson et al. 

2009). Protein feeding by post-teneral Qfly 

has been consistently reported to enhance 

sexual performance (Perez-Staples et al. 

2007, 2008, Prabhu et al. 2008). Bacteria 

on the surfaces of leaves and fruit appear 

to be a key food source for Qfly (Drew 

1987, Drew and Lloyd 1987, Fletcher 1987). 

However in fruit fly free regions of southern 

Australia, populations of these bacteria 

may be infrequent and erratic owing 

to unfavourable climate (Drew et al. 1984, 

Courtice and Drew 1984). In the absence 

of these bacteria, Qfly must find protein 

from alternative ephemeral sources (Perez-Staples 

et al. 2007, Weldon and Taylor 

2011) and therefore a large proportion of 

flies may not reach sexual maturity and 

contribute to population growth. 

Climate in the FFEZ is normally dry 

and crops require irrigation. The combination 

of low humidity and starvation are 

considerably more punitive for Qfly survival 

than starvation alone (Weldon and 

Taylor 2010). Desiccation resistance is generally 

lower for females than males and resistance 

also declines with age. Therefore, 

the lack of available food resources in the 

environment diminishes the chance of survival 

to maturity and the chance to compete 

for a mating. In summary, the FFEZ 

usually presents as a hostile environment 

and affords very limited resources for the 

establishment and spread of Qfly. 

Dispersal before mating 

Qfly actually spend very little time flying. 

Fletcher (1973, 1989) noted that flies spend 

most of their time making trivial flights 

or walking within the tree canopy. In response 

to higher fruit abundance, both 

male and female Qfly visit more leaves 

and hence spend more time in trees containing 

more fruit (Dalby-Ball and Meats 

2000). Flies move around the canopy primarily 

by walking, and when they do fly, 

it is usually over distances of less than 50 

mm in an upward direction. In laboratory 

observations, wild Qfly spend only about 

0.6% of their time in flight with walking 

(67.5%), inactivity (18.0%) and grooming 

(14%) taking up the remainder of their 

time (Weldon et al. 2010). In the field, Ero 

et al. (2011) reported that resting was the 

most commonly observed behaviour for 

Qfly while feeding was rarely observed. 

The flight activity patterns and shortrange 

dispersal patterns of emerged adults 

are similar for male and female Qfly (Weldon 

and Meats 2007, Weldon et al. 2010). 

Clarke and Dominiak (2010) found a high 

correlation between male and female trap 

catches and suggested that changes in 

male distribution also reflect the distribution 

of female Qfly. Fletcher (1973) reported 

that the weekly declines of released 

Qfly were similar for males and females. 

Meats (1998) also assumed that males and 

females had similar dispersal. Therefore 

the trapping of male flies is likely to reflect 

a similar number of female flies in the environment. 

Mating after dispersal 

Male Qfly use pheromones and acoustic 

signals to attract sexually receptive 

females, and mate only during a brief period 

of about 30 minutes at dusk (Tychsen 

and Fletcher 1971). Males gather on the 

upwind side of trees, where they release 

pheromone and fan their wings, directing 

the pheromone stream through the foliage 

(Tychsen 1977). Male calling is energetically 

expensive and calling in aggregations 

maximizes their chances of mating success 

(Weldon 2007). Males downwind of an aggregation 

might fly upwind in response 

to pheromone being released by calling 

males. There is a period of only about ten 

minutes during which males could fly to 

join the flying swarm (Tychsen 1977), and 

only enough time to mate once at each 

dusk, although males may mate in many 

dusk periods over their lifetime (Fay and 

Meats 1983, Radhakrishnan and Taylor 

2008, Radhakrishnan et al. 2009). Males do 

not mate when temperatures at dusk are 

below 15°C with 50% of males mating at 

20°C or higher temperatures (Meats and 

Fay 2000). Qfly have a relatively poor capacity 

to locate an odour source and it has 

been suggested that pheromones operate 

mainly within a single tree canopy (Meats 

and Hartland 1999, Weldon 2007). Acoustic 

cues are only effective over a short distance 

of about 50 cm (Mankin et al. 2004, 

2008, Sivinski personal communication). 

Female Qfly move directly towards the 

males from up to 50 cm away (Tychsen 

1977). 

Odour plumes carried by light winds in 

trees usually become chaotic within a few 

centimetres of their source and provide 

few cues as to the direction of the source 

(Griffiths and Brady 1995). Qfly compensate 

for the diffused odour by making a 

series of short flights or walks (Meats and 

Hartland 1999) or by using large visual 

cues such as foliage to locate the source 

of odours (Dalby-Ball and Meats 2000). 

Female Qfly visit single male Qfly less frequently 

than aggregations (Weldon 2007). 

If the Qfly population is sparse, these limitations 

therefore result in single males being 

unlikely to attract a female and mate. 

Meats (1998) estimated the chance of 

a successful mating between two Qfly on 

the same tree of 5 m × 5 m to be about 0.1%. 

Even in small cages, the chance of mating 

was only 0.8% (Fay and Meats 1983). A 

male Qfly has about a one in 400 chance of 

being in the right place at the right time if 

the density of males in the area was only 

one per hectare. Meats (1998) estimated 

that a single mating was probable when 

there were six male and six female Qfly 

present per hectare. 

Current outbreak thresholds 

Following the detection of small numbers 

of male Qfly (the number depends on the 

importing market), trading partners may 

fear that fruit harvested for trade could 

contain larvae that might establish populations 

in areas currently free from this

pest. In Anon. (1996), a breeding population 

is considered to have three indicators. 

Two are direct indicators; larvae detected 

in fruit harvested within the area 

or a mated female detected in monitoring 

traps. In fruit fly free areas, larval searches 

are not routinely undertaken by regulatory 

authorities at times when no fruit 

flies are detected, although they are sometimes 

conducted to meet some importing 

country requirements. If present, larvae 

are generally detected and reported by 

the public but these are rare events in the 

FFEZ. Because of inefficiency and difficulty 

of detecting larvae, a monitoring grid or 

array has been established to provide an 

early warning of incursions by adult Qfly. 

Qfly populations are known to occur 

naturally in about a 50:50 male:female ratio 

(Dominiak et al. 2008, Clarke and Dominiak 

2010). In the FFEZ, female Qfly are 

poorly attracted to monitoring traps (Dominiak 

et al. 2003a, Dominiak 2006, Dominiak 

and Nicol 2010). However, these 

traps and lures may be more successful 

in tropical regions (Clarke and Dominiak 

2010). Due to the lack of reliable female 

lures, the monitoring array relies primarily 

on the trapping of male flies and this 

is a common situation in most countries 

(International Atomic Energy Agency 

2003). In Australia, Willison discovered 

that male Qfly are attracted to raspberry 

ketone and subsequently experimented 

with a related chemical, cuelure (Allman 

1958). Cuelure breaks down into raspberry 

ketone and this process is accelerated 

in the presence of moisture (Metcalf 1990). 

Sexually mature male Qfly are attracted to 

raspberry ketone in nature (Tan and Nishida 

1995). While male flies trapped may be 

sexually mature, there is no current technology 

which can indicate if a Qfly male 

has mated and therefore that a breeding 

population exists. In the absence of this 

technology, Bateman (1991) proposed that 

five male flies are an indicator of a breeding 

population and this is later supported 

by Meats (1998). 

Conditions under the current code 

Bateman (1991) and subsequently Anon. 

(1996) recommended that five male flies 

trapped within 1 km of each other within 

a 14 day period was an appropriate outbreak 

threshold, or in essence indicated 

unacceptable risk of a breeding population. 

This standard has been accepted 

for domestic trade within Australia and 

by many international trading partners. 

However, some countries choose lower 

outbreak thresholds. Presumably, these 

lower standards are thought to provide a 

higher level of assurance, but there have 

been no empirical studies to support this. 

As part of the 5-fly standard in Anon. 

(1996), there is an intermediate step, presumably 

to further investigate for the presence 

of a breeding population. When two 

male flies are detected within one kilometre 

of each other within 14 days, 31 supplementary 

traps must be deployed within 

200 metres (the outbreak zone) of the 2-fly 

detection and fruit must be checked for 

larvae. Supplementary traps must stay 

in place for nine weeks and be inspected 

twice weekly. If fewer than five male Qfly 

are trapped within 1 km within any 14 

day period, an outbreak is not declared. 

In essence, it is deemed that a breeding 

population does not exist. If a total of five 

or more Qfly are detected within any 14 

day period, an outbreak is declared for all 

domestic and international markets. After 

the outbreak declaration, no produce 

within the outbreak zone (within 200 m 

of the detection point) can be traded. All 

produce between 200 m and 15 km (the 

suspension area) must be treated with an 

approved disinfestation protocol before 

being transported into or sold in fruit fly 

sensitive markets (Jessup et al. 1998, De 

Lima et al. 2007). 

The detection date of the last fly 

trapped is used to determine the reinstatement 

of area freedom based on generation 

tables in Anon. (1996). For some 

countries, these reinstatement periods 

vary from one generation plus 28 days, 

12 weeks, three generations and one year. 

However apart from noting these differing 

standards, these reinstatement periods 

will not be discussed in detail further in 

this paper. Some countries have adopted 

the 2-fly threshold (within 400 m) as the 

outbreak threshold rather than the 5-fly 

threshold (within 1 km). For Australian 

exporters and regulators, the different outbreak 

thresholds result in disrupted trade 

and an administration burden. Moreover, 

the disparity in outbreak thresholds and 

reinstatement periods places regulatory 

authorities in a difficult position, needing 

to impose movement controls on host 

commodities destined for markets with 

different requirements. 

Implications for different outbreak 

thresholds 

Australian states and territories have 

agreed to the 5-fly threshold as an outbreak 

threshold. This agreement allows 

susceptible produce to be traded based 

on the specified conditions before or after 

an outbreak is declared. What happens 

when a trading partner requires a different 

threshold? 

In the Australian response, the detection 

of two flies requires the deployment 

of supplementary traps and fruit searches. 

However since the Australian 5-fly outbreak 

threshold is not reached, no movement 

controls are imposed and fruit may 

move unrestricted from a 2-fly zone to 

any part of the pest free area or the rest 

of Australia. Further, no chemical control 

measures are deployed. This contrasts 

with countries that are more risk averse 


and use a 2-fly threshold. A fruit fly outbreak 

in any country normally requires 

an eradication response and movement 

controls. Since Australia does not deploy 

these responses for a 2-fly threshold, the 

interpretation by a 2-fly importing country 

is that potentially infested produce can 

move from the area immediately around 

the 2-fly threshold to any other district. 

What is the Australian response to these 

mixed thresholds? Australia only imposes 

eradication or movement controls after 

a 5-fly threshold and therefore countries 

using the 2-fly threshold may deem the 

entire or part of the pest free area infested. 

Trade in fruit fly host commodities under 

area freedom arrangements into 2-fly 

sensitive markets is likely to cease for the 

entire or part of the pest free area. Costly 

phytosanitary treatments are usually required 

for these 2-fly markets. The alternative 

is that Australia aligns its trade standard 

with the 2-fly threshold, and moves to 

a lower universal outbreak threshold. This 

action would decrease fruit fly free trade 

because the 2-fly threshold is reached 

more frequently than the 5-fly threshold. 

Due to the difficulties in servicing markets 

with different outbreak thresholds, 

would markets currently accepting the 

5-fly threshold then also align with the 

2-fly threshold? This possible change in 

outbreak threshold results in potentially 

all countries accepting the lowest outbreak 

threshold. One country is even more risk 

averse, requiring a 1-fly threshold for 

Qfly. If this strategy was adopted internationally 

by all countries for all species, the 

1-fly threshold would become an unreasonable 

burden on all international trade. 

This strategy would significantly increase 

pesticide use in field eradication programs 

and cause most fruit to be unnecessarily 

treated with undesirable impact on the 

environment; some chemicals such as methyl 

bromide are green house gases. There 

would be significant benefits in harmonizing 

outbreak thresholds, but empirical evidence 

is required to support a preferred 

universal threshold. 

New information published since 

the early 1990s. 

Bateman’s (1991) report was the basis for 

the current thresholds for outbreaks and 

these were adopted as a code of practice 

(Anon. 1996). More data of Qfly outbreaks 

have been published since Bateman (1991) 

and Anon. (1996), and these more recent 

publications may prove instructive in assessing 

the relative merits of the 5-fly and 

2-fly thresholds. The monitoring grid is 

either a 400 m array in towns or a 1000 

m array in orchards (Anon. 1996, Meats 

1998). Fruit flies are reported to rarely disperse 

as far as one kilometre over their 

lifetime (Maelzer 1990, Bateman 1991, 

Meats 1996, Dominiak et al. 2003b, Meats 

et al. 2003, 2006, Meats and Edgerton 2008,


Weldon and Meats 2010, Gilchrist and 

Meats 2011). Given the large size of the 

FFEZ, we can then surmise that introductions 

of Qfly usually result from the 

carriage by humans of infested produce, 

and this is supported by assessment at 

roadblocks (Bateman 1972, Dominiak et 

al. 2000, Sved et al. 2003, Maelzer et al. 2004, 

Dominiak and Coombes 2009). Clift and 

Meats (2005) used Bayesian scenario analysis 

to show that introductions by local 

inhabitants contributed more to outbreaks 

than passing travellers. Most humans reside 

in urban areas and therefore the more 

intense monitoring array (400 m) in towns 

is a reflection of the greater risk (Meats 

1998, Maelzer et al. 2004). Townships 

also provide better environments for survival 

and development of fruit flies than 

the surrounding rural areas (Yonow and 

Sutherst 1998, Raghu et al. 2000, Dominiak 

et al. 2006). Backyard environments are 

typically well watered and contain both 

sheltered microclimates and host fruit 

trees. Larger urban areas have an urban 

heat island which further minimizes the 

adverse effects of cold weather (Torok et 

al. 2001, Dominiak et al. 2006). The one kilometre 

grid is used in lower risk rural and 

orchard areas. These relatively sparsely 

populated rural areas are unlikely to be 

the first point of introduction of infested 

fruit and if they are, rural areas generally 

provide less favourable environments for 

fruit fly survival (Dominiak et al. 2006). 

Meats (1998) suggests that a detection 

of two male flies within a two week period 

on the one kilometre grid represents 

a density between 2.1 and 6.57 flies per 

hectare within the outbreak zone (200 m 

radius from the discovery point). The upper 

estimate of 6.57 flies per hectare represents 

the most extreme situation in which 

the source of the incursion is directly in the 

centre of four adjacent traps in a grid, maximizing 

its distance from any trap. Meats 

(1998) proposed that when the density of 

flies within the outbreak zone exceeded 

six flies per hectare (of each sex), there was 

potential (albeit a very low risk) for one 

pair to mate. Superficially, the upper estimate 

of 6.57 flies per hectare appears to 

exceed the minimum density required for 

a mating to occur by 0.57 flies per hectare. 

However the theoretical minimum breeding 

density proposed by Meats (1998) of 

six male flies is an extremely conservative 

estimate and is essentially only a ‘best 

guess’ based on the information available 

at that time. Several critical factors used to 

obtain this theoretical minimum breeding 

estimate remain poorly understood. Meats 

(1998) estimated that the probability of a 

successful mating in the field was less than 

0.1 although in calculating the minimum 

breeding density, the model assumed that 

it was equal to 0.1. This estimate of 0.1 was 

based on unpublished observations and 

has not been substantiated with data or 

confirmed experimentally in the field. The 

model also assumes that there are ten dusk 

periods available for mating and that mating 

can occur each and every dusk period. 

Tychsen and Fletcher (1971) concluded 

that mating only occurs within a 30 minute 

period each day so that sexually mature 

flies must be in close proximity at this time 

for mating to occur. Meats (1998) acknowledges 

that his estimate of ten dusk periods 

is also too high as it does not take into account 

adverse weather, the inhospitable 

environment, and other factors unfavourable 

to fruit flies. In reality, mating will 

only occur under favourable conditions 

and in the presence of an adequate population. 

Another factor included in the estimate 

was dispersal behaviour observed by 

Fletcher (1973, 1974a, 1974b) in a commercial 

orchard at Wilton, New South Wales. 

Fletcher’s conclusions are specific to the 

coastal environment where his study was 

conducted and cannot be directly applied 

to inland pest free areas that are much less 

favourable to fruit flies (Dominiak et al. 

2006). Meats (1998) also acknowledged in 

his closing remarks that verification of the 

models is still required and to date this issue 

remains unresolved. Meats (1998) recognized 

that his interpretation of trapping 

rates on the 1 km grid is conservative, and 

accordingly did not recommend that the 

detection of two flies should be the threshold 

for quarantine precautions, but rather 

a threshold to intensify the grid. 

Data for 2007–2009 period 

The period from February 2007 to April 

2009 was chosen as a base to compare 

2-fly and 5-fly thresholds. Information 

was provided by the state departments 

of agriculture in Victoria and New South 

Wales; there were no outbreaks in the 

South Australian portion of the FFEZ 

during this period. Climatically, autumn 

2007 experienced near neutral values for 

the Southern Oscillation Index (SOI) with 

most parts of New South Wales and Victoria 

receiving average rainfall (Braganza 

2008). The study area received slightly 

above average rainfall in spring and summer 

of 2007 followed by dry conditions 

in autumn, winter and spring 2008 (Duell 

2009, Qi 2009). Average to below average 

rainfall occurred in the FFEZ in summer 

2008–2009 and autumn 2008 however several 

exceptional heatwaves occurred in 

February 2009 (Mullen 2009). In this period, 

there were 27 outbreaks and these 

were allocated to one of two categories. 

Category A was a response after detection 

of two flies, where 31 supplementary 

traps were deployed and larval searches 

undertaken according to Anon. (1996). No 

eradication or product movement controls 

were imposed. Trade to countries using 

the 2-fly threshold would have been suspended 

for that area. Trade was reinstated 

only after no flies were trapped for a 

period of one generation plus 28 days. 

There was no restriction of trade with any 

Australian states or any 5-fly markets. 

There were 19 outbreaks in this category 

(Victoria: Invergorden 18 March 2008; Cobram 

12 March 2008; Barooga 13 March 

2008; Shepparton 10 April 2008; Bunbartha 

11 April 2008; Katunga 14 April 2008; Numurkah 

15 April 2008; Cobram East 2 June 

2008; Echuca 18 September 2008; Irymple 

24 March 2009. New South Wales: Yenda 

11 April 2007; Darlington Point 26 April 

2007; Yanco 29 May 2007; Lake Wyangan 

12 March 2008; Hillston town 15 April 

2008; Yenda 16 April 2008; Yanco 16 September 

2008; Leeton town 16 September 

2008; Hillston orchard 22 September 2008). 

Category B was based on a 5-fly threshold. 

Subsequent procedures were according 

to Anon. (1996); supplementary traps 

and larval searches were conducted, 

eradication programs and product movement 

controls were initiated, and a 15 km 

suspension zone was established. Trade in 

fruit fly free produce to all domestic and 

international markets (including countries 

using the 2-fly threshold) was suspended 

for all host commodities grown within the 

suspension zone until there were no flies 

trapped for one generation plus 28 days. 

There were eight outbreaks in this category 

(Victoria: Koonoomoo 2 February 

2007; Invergordon 20 March 2008; Bunbartha 

22 April 2008; Katunga 13 May 2008; 

Cobram East 19 June 2008; Shepparton 3 

April 2009. New South Wales; Narrandera 

23 May 2007; Yanco 28 October 2008.) 

Of the 27 outbreaks, 19 Category A 

outbreaks (70.4% of all outbreaks) did 

not progress to a Category B outbreak 

despite supplementary trapping and larval 

searches. Even with the low level of 

progression to the 5-fly threshold (29.6%), 

all susceptible host produce from the pest 

free area required disinfestation before 

being exported to markets requiring any 

threshold other than the 5-fly threshold. 

Meats et al. (2003) found 71% of single Qfly 

detections did not lead to 5-fly outbreaks 

and self extinguished without any eradication 

response. The 2007–2009 data for 

the 2-fly threshold of 70.4% is consistent 

with Meats et al. (2003). 

Riverina trade volume since 1996 

There has been considerable trade in host 

produce from the FFEZ since 1996 using 

the 5-fly threshold without any reports of 

larvae found in produce. This confirms 

that area freedom certification procedures 

for Australia’s pest free area are robust 

given that consumers are highly likely to 

report and return damaged fruit to retailers. 

The volume of produce varies from 

year to year. Australian Bureau of Statistics 

(2008) reported that, for the statistic 

local areas of Carrathool, Griffith, Leeton 

and Murrumbidgee, 8586, 166 689 and 

172 387 tonnes of stone fruit, oranges and

other citrus respectively was produced. 

These combined industries are valued at 

$86.492 M (Australian Bureau of Statistics 

2008). Given the volume and value of fruit 

traded annually, if the 2-fly threshold was 

an accurate indicator of crop infestation, it 

is likely that Qfly would have been detected 

in consignments in domestic or international 

market during the past 15 years. 

Closing comments 

Qfly is recognized as a poor colonizer in 

fruit fly free areas such as the FFEZ, owing 

to hostile conditions for survival and reproduction 

(Bateman 1972, 1977, Fletcher 

1987, Edge et al. 2001, Meats et al. 2003, 

Weldon 2007). Even introduction by human 

activity (jump dispersal) very rarely 

results in establishment (Maelzer et al. 

2004, Meats and Edgerton 2008). Given the 

large volume of produce traded without 

incident, the 5-fly threshold has a proven 

track record of success in providing highly 

effective phytosanitary assurance. Based 

on the evaluation of outbreak data, there is 

no indication that the 2-fly threshold provides 

any additional assurance. On this 

basis, we recommend that international 

trading partners adopt the 5-fly threshold 

as a universal threshold that provides a 

high level of assurance and also enables 

increased trading opportunity. 

Acknowledgments 

The authors would like to thank the many 

trap inspectors who inspect and report 

on fly detections in Victoria and New 

South Wales. The identification services 

in both states are also greatly appreciated. 

The administration and Information and 

Communications Technology services in 

state Departments also make a significant 

contribution to maintaining and reporting 

of databases which provided the information 

in this paper. Earlier versions of this 

manuscript were improved by comments 

from Satendra Kumar, Sarah Sullivan, Lionel 

Hill and Associate Prof Phil Taylor. 

References 

Allman, S.L. (1958). Queensland fruit fly. 

New South Wales Department of Agriculture. 

Conference of Commonwealth 

and State Entomologists. Brisbane, May 

1957. Commonwealth Scientific and 

Industrial Research Organisation, pp. 

68-70. 

Allwood, A. (2000). Regional approach 

to the management of fruit flies in the 

Pacific Island countries and territories. 

In ‘Area-wide control of fruit flies and 

other insect pests’, ed. K.H. Tan, pp. 

439-48. (Penerbit Universiti Sains Malaysia, 

Penang). 

Anon. (1996). Code of practice for the 

management of Queensland fruit fly. 

Standing Committee on Agriculture 

and Resource Management, Department 

of Primary Industries, Canberra. 

Australian Bureau of Statistics (2008). 

Agricultural commodities: small area 

data, Australia, 2005–2006. Report 

71250DO003. 

Bateman, M.A. (1972). The ecology of fruit 

flies. Annual Review of Entomology 17, 

493-518. 

Bateman, M.A. (1977). Dispersal and species 

interactions as factors in the establishment 

and success of tropical fruit 

flies in new areas. Proceedings of the Ecological 

Society of Australia 10, 106-12. 

Bateman, M.A. (1991). The impact of fruit 

flies on Australian horticulture. Horticultural 

Policy Council Report No. 3. 

ISBN 0642161100. 

Braganza, K. (2008). Seasonal climate summary 

southern hemisphere (autumn 

2007): La Nina emerges as a distinct 

possibility in 2007. Australian Meteorological 

Magazine 57, 65-75. 

Clarke, A.R. and Dominiak, B.C. (2010). 

Positive correlation of male and female 

Bactrocera tryoni (Froggatt) (Diptera: Tephritidae) 

catches in orange-ammonia 

traps. General and Applied Entomology 

39, 9-13. 

Clarke, A.R., Powell, L.S., Weldon, C.W. 

and Taylor, P.W. (2011). The ecology 

of Bactrocera tryoni (Diptera: Tephritidae): 

what do we know to assist pest 

management? Annals of Applied Biology 

158, 26-54. 

Clift, A. and Meats, A. (2005). Use of a 

Bayesian Belief Network to identify situations 

that favour fruit fly incursions 

in inland SE Australia. International 

Congress on Modelling and Simulation 

MODSIM 2005, eds A. Zerger and R.M. 

Argent, pp. 170-6. (Modelling and Simulation 

Society of Australia and New 

Zealand). 

Courtice, A.C. and Drew, R.A.I. (1984). 

Bacterial regulation of abundance in 

tropical fruit flies (Diptera: Trephritidae). 

Australian Zoology 21, 251-68. 

Dalby-Ball, G. and Meats, A. (2000). Influence 

of the odour of fruit, yeast and 

cuelure on the flight activity of the 

Queensland fruit flies, Bactrocera tryoni 

(Froggatt) (Diptera: Tephritidae). Australian 

Journal of Entomology 39, 195-200. 

De Lima, C.P.F., Jessup, A.J., Cruickshank, 

L., Walsh, C.J. and Mansfield, 

E.R. (2007). Cold disinfestation of citrus 

(Citrus spp.) for Mediterranean fruit fly 

(Ceratitis capitata) and Queensland fruit 

fly (Bactrocera tryoni) (Diptera: Tephritidae). 

New Zealand Journal of Crop and 

Horticultural Science 35, 39-50. 

Dominiak, B.C. (2006). Review of the use 

of protein food based lures in McPhail 

traps for monitoring Queensland fruit 

fly Bactrocera tryoni (Froggatt) (Diptera: 

Tephritidae). General and Applied Entomology 

35, 7-12. 

Dominiak, B.C., Campbell, M., Cameron, 

G. and Nicol, H. (2000). Review 

of vehicle inspection historical data as 


a tool to monitor the entry of hosts of 

Queensland fruit fly Bactrocera tryoni 

(Froggatt) (Diptera: Tephritidae) into a 

fruit fly free area. Australian Journal of 

Experimental Agriculture 40, 763-71. 

Dominiak, B.C. and Coombes, N.M. 

(2009). Fruit carrying characteristics 

of travellers into a quarantine zone in 

New South Wales in 1999/2000. Plant 

Protection Quarterly 24, 14-19. 

Dominiak, B.C., Gilmour, A.R., Kerruish, 

B. and Whitehead, D. (2003a). Detecting 

low populations of Queensland 

fruit fly Bactrocera tryoni (Froggatt) with 

McPhail and Lynfield traps. General and 

Applied Entomology 32, 49-53. 

Dominiak, B.C., Mavi, H.S. and Nicol, 

H.I. (2006). Effect of town microclimate 

on the Queensland fruit fly Bactrocera 

tryoni. Australian Journal of Experimental 

Agriculture 46, 1239-49. 

Dominiak, B.C., McLeod, L.J. and Landon, 

R. (2003b). Further development 

of a low-cost release method for sterile 

Queensland fruit fly, Bactrocera tryoni 

(Froggatt) in rural New South Wales. 

Australian Journal of Experimental Agriculture 

43, 407-17. 

Dominiak, B.C. and Nicol, H.I. (2010). 

Field performance of Lynfield and 

McPhail traps for monitoring male and 

female sterile (Bactrocera tryoni Froggatt) 

and wild Dacus newmani (Perkins). 

Pest Management Science 66, 741-4. 

Dominiak, B.C., Sundaralingham, S., Jiang, 

L., Jessup, A.J. and Barchia, I.M. (2008). 

Production levels and life history traits 

of mass reared Queensland fruit fly 

Bactrocera tryoni (Froggatt) (Diptera: Tephritidae) 

during 1999/2002 in Australia. 

Plant Protection Quarterly 23, 131-5. 

Drew, R.A.I. (1974). The responses of fruit 

fly species (Diptera: Tephritidae) in the 

South Pacific area to male attractants. 

Journal of the Australian Entomological 

Society 13, 267-70. 

Drew, R.A.I. (1987). Behavioural strategies 

of fruit flies of the genus Dacus (Diptera: 

Tephritidae) significant in mating 

and host-plant relationships. Bulletin of 

Entomological Research 77, 73-81. 

Drew, R.A.I. (1989). The tropical fruit flies 

(Diptera: Tephritidae) of the Australasian 

and Oceanian regions. Memoirs of 

the Queensland Museum. 26, 1-521. 

Drew, R.A.I. and Lloyd, A.C. (1987). Relationship 

of fruit flies (Diptera: Tephritidae) 

and their bacteria to host plants. 

Annals of the Entomological Society of 

America 80, 629-36. 

Drew, R.A.I., Zalucki, M.P. and Hooper, 

H.H.S. (1984). Ecological studies of 

Eastern Australia fruit flies (Diptera: 

Tephritidae) in their endemic habitat. 

I. Temporal variation in abundance. 

Oecologia (Berlin) 64, 267-72. 

Duell, R. (2009). Seasonal climate summary 

southern hemisphere (autumn 2008): 

a return to neutral ENSO conditions


in the tropical Pacific. Australian Meteorological 

and Oceanographic Journal 58, 

63-77. 

Edge, V., Gardner, R., Green, A., Cock, K. 

and Cornish, J. (2001). Technical review 

of the Tri-State Strategy for Queensland 

Fruit Fly. Report to Standing Committee 

on Agriculture and Resource Management. 

January 2001, 62 pp. 

Ero, M.M., Hamacek, E. and Clarke, A.R. 

(2011). Foraging behaviours of Diachasmimorpha 

kraussi (Fullaway) (Hymenoptera: 

Braconidae) and its host 

Bactrocera tryoni (Froggatt) (Diptera: 

Tephritidae) in a nectarine (Prunus persica 

(L.) Batsch var. nectarina (Aiton) 

Maxim) orchard. Australian Journal of 

Entomology 50, 234-40. 

Fanson, B.G., Weldon, C.W., Perez-Staples, 

D., Simpson, S.J. and Taylor, P.W. 

(2009). Nutrients, not caloric restriction, 

extend lifespan in Queensland fruit flies 

(Bactrocera tryoni). Aging Cell 8, 1-10. 

Fay, H.A.C. and Meats, A. (1983). The effects 

of age, ambient temperature, thermal 

history and mating history on mating 

frequency in males of the Queensland 

fruit fly, Dacus tryoni. Entomologia 

Experimentalis et Applicata 35, 273-6. 

Fletcher, B.S. (1973). The ecology of a natural 

population of the Queensland fruit 

fly, Dacus tryoni IV. The immigration 

and emigration of adults. Australian 

Journal of Zoology 21, 541-65. 

Fletcher, B.S. (1974a). The ecology of a 

natural population of the Queensland 

fruit fly, Dacus tryoni V. The dispersal 

of adults. Australian Journal of Zoology 

22, 189-202. 

Fletcher, B.S. (1974b). The ecology of a natural 

population of the Queensland fruit 

fly, Dacus tryoni VI. Seasonal changes in 

fruit fly numbers in the areas surrounding 

the orchard. Australian Journal of Zoology 

22, 353-63. 

Fletcher, B.S. (1987). The biology of dacine 

fruit flies. Annual Review of Entomology 

32, 115-44. 

Fletcher, B.S. (1989). Movements of tephritid 

fruit flies. In ‘Fruit flies, their 

biology, natural enemies and control’ 

Vol. 3B, eds A.S. Robinson and G. 

Hooper, pp. 209-19. (Elsevier, Amsterdam). 

Gilchrist, A.S. and Meats, A.W. (2011). 

Factors affecting the dispersal of largescale 

releases of the Queensland fruit 

fly, Bactrocera tryoni. Journal of Applied 


Griffiths, N. and Brady, J. (1995). Wind 

structure in relation to odour plumes 

in tsetse fly habitats. Physiological Entomology 

20, 286-92. 

Hancock, D.L., Hamacek, E.L., Lloyd, A.C. 

and Elson-Harris, M.M. (2000). The distribution 

and host plants of fruit flies 

(Diptera: Tephritidae) in Australia. DPI 

Publications, Brisbane, Australia. ISSN 

0727-6273. 

International Atomic Energy Agency 

(2003). Trapping guidelines for areawide 

fruit fly programmes. International 

Atomic Energy Agency, Vienna. 

pp. 47. 

Jessup, A.J., Carswell, I.F. and Dalton, S.P. 

(1998). Disinfestation of fresh fruits 

from Bactrocera tryoni (Froggatt) (Diptera: 

Tephritidae) with combination 

mild heat and modified atmosphere 

packaging. Australian Journal of Entomology 

37, 186-8. 

Li, B., Ma, J., Hu, X., Liu, H., Wu, J., Chen, 

H. and Zhang, R. (2010). Risk of introducing 

exotic fruit flies, Ceratitis capitata, 

Ceratitis cosyra and Ceratitis rosa 

(Diptera: Tephritidae), into southern 

China. Journal of Economic Entomology 

103, 1100-11. 

Maelzer, D.A. (1990). Fruit fly outbreaks in 

Adelaide, S.A., from 1948–49 to 1986– 

87. I. Demarcation, frequency and temporal 

patterns of outbreak. Australian 

Journal of Zoology 38, 439-52. 

Maelzer, D.A., Bailey, P.T. and Perepelicia, 

N. (2004). Factors supporting the 

non-persistence of fruit fly populations 

in South Australia. Australian Journal of 

Experimental Agriculture 44, 109-26. 

Mankin, R.W., Anderson, J.B., Mizrach, A., 

Epsky, N.D., Shuman, D., Heath, R.R., 

Mazor, M., Hetzroni, A., Grinshpun, J., 

Taylor, P.W. and Garrett, S.L. (2004). 

Broadcasts of wing-fanning vibrations 

recorded from calling male Ceratitis 

capitata (Diptera: Tephritidae) increases 

captures of females in traps. Journal of 

Economic Entomology 97,1299-309. 

Mankin, R.W., Lemon, M., Harmer, 

A.M.T., Evans, C.S. and Taylor, P.W. 

(2008). Time-pattern and frequency 

analyses of sounds produced by irradiated 

and untreated male Bactrocera 

tryoni (Froggatt) (Diptera: Tephritidae) 

during mating behaviour. Annals of the 

American Entomological Society 101, 664- 

74. 

Meats, A. and Fay, F.A.C. (2000). Distribution 

of mating frequency among males 

of the Queensland fruit fly, Bactrocera 

tryoni (Froggatt), in relation to temperature, 

acclimation and change. General 

and Applied Entomology 29, 27-30. 

Meats, A. and Hartland, C.L. (1999). Upwind 

anemotaxis in response to cuelure 

by the Queensland fruit fly Bactrocera 

tryoni. Physiological Entomology 

24, 90-7. 

Meats, A. and Smallridge, C.J. (2007). 

Short and long range dispersal of Medfly, 

Ceratitis capitata (Diptera: Tephritidae) 

and its invasive potential. Journal 

of Applied Entomology 8, 518-23. 

Meats, A., Smallridge, C.J. and Dominiak, 

B.C. (2006). Dispersion theory and 

the sterile insect technique: application 

to two species of fruit fly. Entomologia 

Experimentalis et Applicata 119, 

247-54. 

Meats, A.M. (1996). Demographic analysis 

of sterile insect trials with Queensland 

fruit fly Bactrocera tryoni (Froggatt) 

(Diptera: Tephritidae). General and Applied 


Meats, A.M. (1998). The power of trapping 

grids for detecting and estimating 

the size of invading propagules of the 


(Froggatt) (Diptera: Tephritidae) risks 

of subsequent infestation. General and 


Meats, A.M., Clift, A.D. and Robson, M.K. 

(2003). Incipient founder populations 

of Mediterranean and Queensland fruit 

flies in Australia: the relation of trap 

catch to infestation radius and models 

for quarantine radius. Australian Journal 

of Experimental Agriculture 43, 397-406. 

Meats, A.M. and Edgerton, J.E. (2008). 

Short- and long-distance dispersal of 


and its relevance to invasive potential, 

sterile insect technique and surveillance 

trapping. Australian Journal of Experimental 


Metcalf, R.L. (1990). Chemical ecology of 

Dacine fruit flies (Diptera: Tephritidae). 

Annals of the Entomological Society 

of America 83, 1017-30. 

Mullen, C. (2009). Seasonal climate summary 

southern hemisphere (summer 

2008-09): a weak, brief La Nina returns. 

Bumper wet season in tropical Australia: 

exceptional heatwaves in southeastern 

Australia. Australian Meteorological 

and Oceanographic Journal 58, 275-84. 

Oliver, J. (2007). Summary of national fruit 

fly-related activities released. Plant 

Protection News. February 2007. Department 

of Agriculture, Fisheries and 

Forestry. 

Perez-Staples, D., Harmer, A.M.T., Collins, 

S.R. and Taylor, P.W. (2008). Potential 

for pre-release diet supplements 

to increase the sexual performance and 

longevity of male Queensland fruit 

flies. Agricultural and Forest Entomology 

10, 255-62. 

Perez-Staples, D., Prabhu, V. and Taylor, 

P.W. (2007). Post-teneral protein feeding 

enhances sexual performance of 

Queensland fruit flies. Physiological Entomology 

32, 127-35. 

Plant Health Australia (2010). National 

Plant Biosecurity Strategy. Plant Health 

Australia, Deakin, Australian Capital 

Territory. 

Prabhu, V., Pérez-Staples, D. and Taylor, 

P.W. (2008). Protein: carbohydrate ratios 

promoting sexual activity and longevity 

of male Queensland fruit flies. 

Journal of Applied Entomology 132, 575- 

82. 

Qi, L. (2009). Seasonal climate summary 

southern hemisphere (spring 2008): La 

Nina pattern returning across equatorial 

Pacific. Australian Meteorological and 

Oceanographic Journal 58, 199-208.

Radhakrishnan, P., Perez-Staples, D., 

Weldon, C.W. and Taylor, P.W. (2009). 

Multiple mating and sperm depletion 

in male Queensland fruit flies: effects 

on female remating behaviour. Animal 

Behaviour 78, 839-46. 

Radhakrishnan, P. and Taylor, P.W. (2008). 

Ability of male Queensland fruit flies 

to inhibit receptivity in multiple mates, 

and the associated recovery of accessory 

glands. Journal of Insect Physiology 

54, 421-8. 

Raghu, S., Clarke, A.R., Drew, R.A.I. and 

Hulsman, K. (2000). Impact of habitat 

modification on the distribution and 

abundance of fruit flies (Diptera: Tephritidae) 

in southeast Queensland. 

Population Ecology 42, 153-60. 

Stanaway, M.A., Zalucki, M., Gillespie, 

P.S., Rodriguez, C.M. and Maynard, 

G.V. (2001). Pest risk assessment of insects 

in sea cargo containers. Australian 


Sved, J.A., Yu, H., Dominiak, B. and Gilchrist, 

A.S. (2003). Inferring modes of 

colonization for pest species using heterozygosity 

comparisons and sharedallele 

test. Genetics 163, 823-31. 

Stephenson, B.P., Gill, G.S.C., Randall, J.L. 

and Wilson, J.A. (2003). Biosecurity approaches 

to surveillance and response 

for new plant pest species. New Zealand 

Plant Protection 56, 5-9. 

Tan, K.H. and Nishida, R. (1995). Incorporation 

of raspberry ketone in the male 

rectal glands of the Queensland fruit 

fly Bactrocera tryoni Froggat (Diptera: 

Tephritidae). Applied Entomology and 

Zoology 30, 494-7. 

Torok, S.J., Morris, J.G., Skinner, C. and 

Plummer, N. (2001). Urban heat island 

features of southeast Australian towns. 

Australian Meteorological Magazine 50, 

1-13. 

Tychsen, P.H. (1977). Mating behaviour of 

the Queensland fruit fly, Dacus tryoni 

(Diptera: Tephritidae), in field cages. 


Society 16, 459-65. 

Tychsen, P.H. and Fletcher, B.S. (1971). 

Studies on the rhythm of mating in the 

Queensland fruit fly, Dacus tryoni. Journal 

of Insect Physiology 17, 2139-56. 

Weldon, C. (2003). Effectiveness of coloured 

unbaited sticky traps for monitoring 

dispersal of gamma-irradiated 


(Froggatt) (Diptera: Tephritidae). General 

and Applied Entomology 32, 55-60. 

Weldon, C. (2007). Influence of male aggregation 

size on female visitation in 


Tephritidae). Australian Journal of Entomology 

46, 29-34. 

Weldon, C. and Meats, A. (2007). Shortrange 

dispersal of recently emerged 

males and females of Bactrocera tryoni 

(Froggatt) (Diptera: Tephritidae) monitored 

by sticky sphere traps baited with 

protein and Lynfield traps baited with 

cue-lure. Australian Journal of Entomology 

46, 160-6. 

Weldon, C. and Meats, A. (2010). Dispersal 

of mass-reared sterile, laboratory-domesticated 

and wild male Queensland 

fruit flies. Journal of Applied Entomology 

134, 16-25. 

Weldon, C.W., Prenter, J. and Taylor, P.W. 

(2010). Activity patterns of Queensland 

fruit flies (Bactrocera tryoni) are affected 

by both mass-rearing and sterilization. 

Physiological Entomology 35, 148-53. 


Desiccation resistance of adult Queensland 

fruit flies Bactrocera tryoni decreases 

with age. Physiological Entomology 35, 

385-90. 


Sexual development of wild and massreared 

male Queensland fruit flies in 

response to natural food sources. Entomologia 

Experimentalis et Applicata 139, 

17-24. 

White, I.M. and Elson-Harris, M.M. (1992). 

‘Fruit flies of economic significance: 

their identification and bionomics’. 

(CAB International, Oxon, UK). 

Yonow, T. and Sutherst, R.W. (1998). 

The geographical distribution of the 

Queensland fruit fly, Bactrocera (Dacus) 

tryoni, in relation to climate. Australian 

Journal of Agricultural Research 49, 935- 

53. 

Plant Protection Quarterly Vol.26(4) 2011 147

APPENDIX 2


The influence of mixtures of parapheromone lures on 

trapping of fruit fly in New South Wales, Australia 

Bernard C. DominiakA,B , Brett KerruishC , Idris BarchiaD , Udai PradhanA , A. 

Stuart GilchristE and Helen I. NicolF A Department of Primary Industries New South Wales, Locked Bag 21, 

Orange, New South Wales 2800, Australia. 

B The Department of Biological Sciences, Macquarie University, New South 

Wales 2109, Australia. 

C Department of Primary Industries New South Wales, PO Box 1087, Griffith, 

New South Wales 2580, Australia. 

D Department of Primary Industries New South Wales, RMB 8, Camden, New 

South Wales 2570, Australia. 

E Fruit Fly Research Laboratory, Evolution and Ecology Research Centre, 

School of Biological, Earth and Environmental Sciences, The University of 

New South Wales, New South Wales 2052, Australia. 

F Nicol Consulting, 95 Ophir Road, Orange, New South Wales 2800, Australia. 

Abstract 

Tephritid fruit flies of economic importance 

are monitored using traps containing 

either cuelure (CL) or methyl eugenol 

(ME) as an attractant. There would 

be potential economic advantages if both 

lures could be combined in a single trap 

without compromising trapping efficiency. 

This study presents results from two 

trials testing combinations of cuelure (4.4 

mL) and methyl eugenol (0.5 mL and 2.2 

mL) in Lynfield traps near Griffith, NSW 

and in Sydney. 

For the Griffith trial, the addition of 

2.2 mL of methyl eugenol to the standard 

cuelure wick quadrupled the overall capture 

of sterile Queensland fruit fly (Qfly) 

although significant differences were detected 

in only one of four trials. Traps 

were placed between 5 and 55 m from 

the release point, and distance had no 

significant effect on the number of flies 

trapped. Time after trap deployment and 

all time interactions were significant. 

The proportion of sterile Qfly trapped 

within three weeks in the first three releases 

was >91% of total flies trapped 

in the CL–ME combinations while the 

CL only treatment recaptured

in inland NSW. The three treatments were 

hung on adjacent trees with an average of 

5.8 m between traps (range 3.1 to 9.3 m). 

The treatments were replicated at 10 different 

sites within the orchard. All traps 

were inspected 30 times from 19 March 

2003 to 30 December 2003. Traps were not 

inspected in June or July (winter). Treatment 

D (ME only) was not used in the 

Griffith trial site since there are no naturally 

occurring ME-responsive species in 

that area. 

Since wild Qfly are quickly eradicated 

at Griffith due to trade requirements, a test 

population of sterile Qfly from a mass rearing 

strain was released. Flies were mass 

reared, dyed, irradiated and transported 

to Griffith under standard protocols established 

for sterile releases (Dominiak et 

al. 2008). Sterile flies were released four 

times (5 March, 22 August, 1 November 

and 5 December 2003) in the orchard. A 

single release site was used and fruit flies 

were released using a pupal release technique 

similar to Dominiak et al. (2003a). 

No additional protein, sugar or water was 

provided for adults. The GPS coordinates 

of the release site and trap sites were taken 

using hand held equipment and the distance 

from the release point to each trap 

was calculated. The proportion of flies recaptured 

in the three weeks following release 

was calculated. Dacus newmani (Perkins) 

(Newman fly), an Australian native 

fruit fly came from the local environment. 

While the trappings are reported here, the 

results were not analysed as the species is 

of no economic importance. 

Sydney trial 

There is an extensive fruit fly trapping array 

in Sydney maintained as part of the 

National Exotic Fruit Fly Monitoring program 

to detect both CL- and ME-responsive 

species (Gillespie 2003). All flies came 

from the local environment. We used 

nine of these trapping sites in the present 

study. Each experimental site already had 

two Lynfield traps in separate trees (treatment 

A and D). 

At the nine experimental sites, an additional 

Lynfield trap was deployed containing 

a mixture of CL and ME, corresponding 

to Treatment C above. Traps 

were inspected 22 times (fortnightly) from 

12 January 2007 to 22 October 2007. New 

CL lures were deployed in January and 

September 2007 as part of the normal replacement 

procedure for the program. 

Data analysis 

In the Griffith experiment, the number 

of male sterile Qfly (Y) for each trap was 

fitted with a linear mixed model as follows: 

log 10 (Y+1) = fixed terms (treatment, 

release, time after release, distance and 

all interactions) + random terms (replicate 

and its interaction with cuelure and 

release). All parameters were estimated 

using Residual Maximum Likelihood 

(REML) estimation. All analyses were run 

on Genstat Windows Version 9 (VSN International 

Ltd 2006). 

For the Sydney data, the number of male 

wild Qfly (Y) for each trap was fitted using 

a linear model: log 10 (Y+1) = fixed terms 

(treatment, fortnight and interactions). 

Non-significant terms were dropped from 

the final model. All analyses were carried 

out in Genstat Versions 13 (VSN international 

Ltd 2010). Other species were not 

analysed due to the low numbers trapped. 

Results 

Griffith trials 

The total number of flies recaptured in the 

Griffith trials is shown in Table 1. While 

trappings varied greatly between trials, 

there was no overall significant difference 

between treatments, but there were significant 

differences within releases (P


Flies per trap 

70 

60 

50 

40 

30 

20 

10 

0 

25/01/07 

8/02/07 

22/02/07 

8/03/07 

Figure 1. Trappings in Sydney of Qfly into cuelure and the cuelure–methyl 

eugenol combination traps. 

no treatment was consistently more effective. 

For the ME attracted species, the combined 

lure (treatment C) greatly reduced 

the numbers of flies trapped. Most notably, 

the number of B. cacuminata (Hering) 

attracted by the combined lure traps was 

only 12% of treatment D (ME-only). 

Discussion 

General 

There is a general taxonomic concept that 

fruit flies are attracted to either CL or ME 

but not a combination of both lures (Drew 

1974), even though both of these lures or 

their derivatives are plant extracts. More 

recent publications suggest that different 

mixture combinations or spatial proximity 

of different lures may affect trap catches. 

B. cucurbitae (Coquillett) is normally attracted 

to CL only. Shelley et al. (2004) 

found that the addition of ME placed in 

the same wick or within 3 m of CL resulted 

in an increase in the capture of B. cucurbitae. 

Vargas et al. (2000) found the response 

of B. cucurbitae to low levels of cross mixtures 

resulted in significant differences 

and that the season had a significant 

effect. 

Liu (1989) found a mixture with 10% 

and 20% ME added to CL was more effective 

than CL alone at attracting Dacus cucurbitae. 

Hooper (1978) noted a Taiwanese 

report that reported D. cucurbitae trapping 

almost doubled as a result of adding ME 

to CL. Of the species normally attracted to 

CL, Hooper (1978) found that the addition 

of ME to the CL wick did not significantly 

decrease the capture of Dacus tryoni, Dacus 

neohumereralis (Hardy) or Callandra aequalis 

(Coquillett). However the capture rate 

was significantly improved when CL and 

ME lures were hung side by side. 

Griffith trials 

Our results have some similarities to 

those of Vargas et al. (2000) and Hooper 

(1978). Like Vargas et al., we found that the 

22/03/07 

5/04/07 

19/04/07 

3/05/07 

17/05/07 

31/05/07 

Date 

14/06/07 

28/06/07 

12/07/07 

CL 

CL − ME 

26/07/07 

9/08/07 

relative numbers of sterile Qfly trapped by 

the different lure mixtures varied greatly 

between the seasons. But like Hooper, 

we found no overall significant effect of 

the different treatment lures on numbers 

trapped. Our treatment B was similar to 

the 10% ME addition to CL tested by Liu 

(1989) who found a 10% ME mixture was 

more effective than CL alone. There are a 

number of possible confounding effects 

that could be affecting relative trapping 

rates. Firstly, there could be differences 

in fly physiology in different seasons affecting 

the reaction of the flies to lures. 

Secondly, environmental variation though 

the year (temperature and/or humidity) 

could affect the quantity or quality of the 

volatiles produced by the different mixtures. 

Differences in the availability of 

natural food sources could also vary seasonally, 

affecting fly responses. Thirdly, 

the responses of the mass reared strain 

may also be different to that of wild flies 

due to the genetic effects of adaptation to 

the mass rearing environment. Overall, 

the variability between the different trials 

at Griffith suggests that more trials will be 

required to identify factors affecting Qfly 

trapping rates. 

Nevertheless for Qfly, treatment C did 

not result in a significant decrease in sterile 

Qfly numbers in three of the four evaluations. 

We infer that using this CL–ME 

mixture for Qfly is unlikely to have any 

detrimental impact on catches. However, 

for treatment B, there was a notable decrease 

in Qfly trapped in the third release, 

lending caution to the conclusion that ME 

has no detrimental impact on catches. 

In our evaluations, a small number of 

traps caught most of the flies. This clumping 

effect was independent of distance 

(at distances up to 55 m) and was similar 

to the findings of Horwood and Keenan 

(1994) and Meats (2007). Meats (2007) 

reported that wild and sterile Qfly had 

clumped distributions, particularly at low 

densities. 

23/08/07 

6/09/07 

20/09/07 

4/10/07 

18/10/07 

We found that trappings did not vary 

significantly over short distances from the 

release point, i.e. within 55 m of the release 

point. Our results are consistent with 

Weldon and Meats (2007) who found no 

significant trend in the recapture rate with 

distance from release point up to 88 m. 

Fletcher (1974) however, proposed a rule 

that the number of the flies captured was 

proportional to the inverse distance from 

release point. Weldon and Meats (2007) 

suggested that Fletcher’s rule probably 

became operational at some point after 

100 m from the release point. Meats and 

Edgerton (2008) reconciled both short and 

longer distance trapping results by showing 

that a long-tailed (Cauchy) distribution 

provides an adequate dispersal model 

for all distances up to 1000 m. 

Dacus newmani were trapped in the 

August, November and December periods 

but not in March. Our results are 

consistent with Gillespie (2003) who reported 

that this species has a major flight 

in spring and was captured in small numbers 

at other times of the year. Our report 

appears to be the first peer reviewed report 

of D. newmani being attracted to the 

CL–ME combination. The addition of ME 

to CL attracted very few non-target species. 

This would be a positive outcome if 

the lure combination was adopted as an 

enhanced male attractant. The trapping of 

large numbers of non-target species is an 

undesirable attribute of wet protein traps 

(Dominiak et al. 2003b, Dominiak 2006). 

Longevity of sterile flies in the field is 

a significant issue impacting on the frequency 

of release. Some species survive 

less than a week and require weekly releases 

(Hernandez et al. 2007). The March 

and November releases for CL attracted 

82.5% and 71.3% respectively (within 

three weeks) of the total treatment catch. 

This is consistent with Dominiak and 

Webster (1998) who reported 85.7% recaptured 

after three weeks. The CL–ME 

combinations seem to attract more flies 

within the 21 day period compared with 

CL alone in the March and November releases. 

Given the perception that the ME 

plume travels a longer distance than the 

CL plume, we suggest that the addition of 

ME might attract more flies from longer 

distances more quickly compared with 

CL alone. This could be an advantage for 

the trapping out technique to quickly deplete 

a population, prior to a sterile release 

deployment. This chemical combination 

could also be useful in the male annihilation 

technique. Vargas et al. (2000) found 

the combination lure lasted well in fibreboard 

discs in the field. 

Sydney trial 

The Sydney trial contrasted with the Griffith 

trial. In Sydney, the mixed lure traps 

caught only half of the number of Qfly 

which were trapped in CL traps. We can

only speculate the reasons for these differences. 

The environmental conditions 

in the drier inland may create a different 

result compared with the moister environment 

of the Sydney basin (our results) or 

the Queensland coast (Hooper 1978, Dominiak 

et al. 2006). Alternatively the difference 

between the trials may be due to 

strain differences: sterile flies were used 

in the Griffith trial and the wild flies were 

trapped in the Sydney trial. Weldon and 

Meats (2010) reported no significant differences 

in the capture of sterile and wild 

flies in Sydney, but that result may be relevant 

to the harsher inland environment. 

Our Sydney trial and that of Hooper (1978) 

were conducted in humid coastal environment. 

Hooper used lower amounts of lure 

(1.5 mL of CL and ME) than the present 

trials. 

The range of species trapped in this 

trial was consistent with those reported 

for Sydney by Osborne et al. (1997) and 

Gillespie (2003). This trial showed that 

treatment C attracted CL responsive species 

(Qfly, D. aequalis and D. absonifacies) 

but only attracted 10% of the ME responsive 

B. cacuminata compared with ME 

alone. Hooper (1978) found that captures 

of B. cacuminata were reduced by the CL– 

ME mixture in comparison to ME alone. 

Shelly et al. (2004) also found the same 

asymmetry between CL and ME responsive 

species. They speculated that this may 

indicate that ME response evolved later in 

Dacinae than CL response. Since B. cacuminata 

is not of economic importance this 

reduction should not influence the use of 

combined traps for surveillance. However, 

since some economically important exotic 

Bactrocera species are ME-responsive, 

this aspect requires further investigation. 

As in the Griffith trial, the CL–ME mixture 

attracted very few non-target species. 

Variation between trials 

Overall, our results show that relative effectiveness 

of different lures was dependent 

on season and location. Fitt (1983) 

found the response of male Dacus opiliae 

(Drew and Hardy) to methyl eugenol 

traps varied with seasonal patterns of 

humidity associated with ‘wet’ and ‘dry’ 

seasons. Recent research has shown that 

the attractiveness of CL can be improved 

by the addition of other compounds. 

Apart from ME as discussed earlier, Khoo 

and Tan (2000) reported that zingerzone 

added to CL had potential to improve the 

monitoring of B. cucurbitae. More research 

is required before the CL–ME mixture can 

be recommended as a replacement for the 

standard CL monitoring lure for Qfly or 

Newman fly. In the Australian context, our 

results are consistent with Hooper (1978) 

indicating that B. tryoni and D. aequalis 

were attracted to the CL–ME combination. 

This paper appears to be the first to report 

that D. newmani and D. absonifacies are 

attracted to the CL–ME combination. Any 

improvement in surveillance efficiency is 

likely to have significant financial benefits 

for all countries monitoring fruit flies. 

Additionally, the CL–ME lure combination 

could also be useful in the male 

annihilation technique in drier inland areas 

(Dominiak et al. 2009) and is worthy 

of additional research. Vargas et al. (2000) 

found the combination lure lasted well in 

fibreboard discs in the field. Our results 

indicate that, on occasion, large numbers 

of CL-responsive flies are attracted to 

mixed lure traps. However, that response 

was highly variable and we know little 

about the factors leading to the highly 

clumped distribution of Qfly in that region. 

The CL–ME combination in monitoring 

and male annihilation is worthy of 

further research. 

Acknowledgments 

The Sydney National Exotic Fruit Fly 

Monitoring program is largely funded by 

the Department of Agriculture, Fisheries 

and Forestry and the Griffith trial was 

funded by Industry and Investment NSW. 

The assistance of trap inspectors is gratefully 

acknowledged. The identification 

staff of Orange Agricultural Institute are 

also gratefully acknowledged. Dr Amrit 

Kathuria, Dr Phil Taylor and Gus Campbell 

provided useful comments on an earlier 

version of this manuscript. 

References 

Allwood, A. (2000). Regional approach 

to the management of fruit flies in the 

Pacific Island countries and territories. 

In ‘Area-wide control of fruit flies and 

other insect pests’, ed. K.H. Tan, pp. 

439-48. (Penerbit Universiti Sains Malaysia, 

Penang). 

Cunningham, R.T. (1989). Parapheromones. 

In ‘Fruit flies, their biology, 

natural enemies and control’, eds A.S. 

Robinson and G. Hooper, World Crop 

Pests Volume 3A, pp. 221-230. (ElsevierScience 

Publishers, Amsterdam). 

Dominiak, B.C. and Webster, A. (1998). 

Sand bed release of sterile Queensland 

fruit fly Bactrocera tryoni (Froggatt) at 

Young, NSW. General and Applied Entomology 

28, 9-11. 

Dominiak, B.C., McLeod, L.J. and Landon, 

R. (2003a). Further development 

of a low-cost release method for sterile 


(Froggatt) in rural New South Wales. 

Australian Journal of Experimental Agriculture 

43, 407-17. 

Dominiak, B.C., Gilmour, A.R., Kerruish, 

B. and Whitehead, D. (2003b). Detecting 

low populations of Queensland 

fruit fly Bactrocera tryoni (Froggatt) with 

McPhail and Lynfield traps. General and 


Dominiak, B.C., Mavi, H.S. and Nicol, 

H.I. (2006). Effect of town microclimate 


on the Queensland fruit fly Bactrocera 

tryoni. Australian Journal of Experimental 


Dominiak, B.C. (2006). Review of the use 

of protein food based lures in McPhail 

traps for monitoring Queensland fruit 

fly Bactrocera tryoni (Froggatt) (Diptera: 

Tephritidae). General and Applied Entomology 

35, 7-12. 

Dominiak, B.C., Gillespie, P.S. and Tom, 

G. (2007). Changes in data management 

and the impediments to change – a case 

study for fruit fly surveillance. Plant 

Protection Quarterly 22, 95-8. 

Dominiak, B.C., Sundaralingham, S., Jiang, 

L., Jessup, A.J. and Barchia, I.M. (2008). 

Production levels and life history traits 

of mass reared Queensland fruit fly 


Tephritidae) during 1999/2002 in Australia. 

Plant Protection Quarterly 23, 

131-5. 

Dominiak, B.C., Clifford, C.S. and Nielsen, 

S.G. (2009). Queensland fruit fly (Bactrocera 

tryoni Froggatt) attraction to and 

chemical analysis of male annihilation 

blocks using three concentrations of 

cuelure at Dubbo, New South Wales, 

Australia. Plant Protection Quarterly 24, 

157-60. 

Drew, R.A.I. (1974). The responses of fruit 

fly species (Diptera: Tephritidae) in the 

South Pacific area to male attractants. 


Society 13, 267-70. 

Fitt, G.P. (1983). The influence of seasonal 

climatic factors on the development of 

the methyl eugenol response in male 

Dacus opiliae. Entomologia Experimentalis 

et Applicata 33, 171-8. 

Fletcher, B.S. (1974). The ecology of a 

natural population of the Queensland 

fruit fly, Dacus tryoni V. The dispersal 

of adults. Australian Journal of Zoology 

22, 189-202. 

Gillespie, P. (2003). Observations on fruit 

flies (Diptera: Tephritidae) in New 

South Wales. General and Applied Entomology 

32, 41-7. 

Hernandez, E., Orozco, D., Breceda, S.F. 

and Dominguez, J. (2007). Dispersal 

and longevity of wild and mass reared 

Anastrepha ludens and Anestrepha obliqua 

(Diptera: Tephritidae). Florida Entomologist 

90, 123-35. 

Hooper, G.H.S. (1978). Effect of combining 

methyl eugenol and cuelure on the capture 

of male tephritid fruit flies. Journal 

of the Australian Entomological Society 17, 

189-90. 

Horwood, M.A. and Keenan, P.J. (1994). 

Eradication of Queensland fruit fly. 

Final report CT336. Horticultural Research 

and development corporation, 

Canberra. 

IAEA (2003). Trapping guidelines for area-wide 

fruit fly programmes. International 

Atomic Energy Agency, Vienna. 

47 pp.


Ito, T., Teruya, T. and Sakiyama, M. (1976). 

Attractiveness of fibre-blocks containing 

mixture of methyl eugenol and cuelure 

on Dacus dorsalis and Dacus cucurbitae. 

Bulletin of Okinawa Agricultural 

Experimental Station 2, 39-43. 

Khoo, C.C. and Tan, K.H. (2000). Attraction 

of both sexes of Melon fly, Bactrocera 

cucurbitae to conspecific males 

– a comparison after pharmacophagy of 

cue-lure and a new attractant – zingerzone. 

Entomologia Experimentalis et Applicata 

97, 317-20. 

Liu, Y.C. (1989). Development of attractants 

for controlling the melon fly, Dacus 

cucurbitae Coquillett, in Taiwan. Chinese 

Journal of Entomology. Special Publication 

4, 128-9. 

Meats, A. (2007). Dispersal of fruit flies 

(Diptera: Tephritidae) at high and 

low densities and consequences of 

mismatching dispersions of wild and 

sterile flies. Florida Entomologist 90 (1), 

136-46. 

Meats, A.M. and Edgerton, J.E. (2008). 

Short- and long-distance dispersal of 


and its relevance to invasive potential, 

sterile insect technique and surveillance 

trapping. Australian Journal of Experimental 


Oliver, J. (2007). Summary of national fruit 

fly-related activities released. Plant 

Protection News. February 2007. Department 

of Agriculture, Fisheries and 

Forestry. 

Osborne, R., Meats, A., Frommer, M., 

Sved, J.A., Drew, R.A.I. and Robson, 

M.K. (1997). Australian distribution 

of 17 species of fruit flies (Diptera: Tephritidae) 

caught in cuelure traps in 

February 1994. Australian Journal of Entomology 

36, 45-50. 

Reid, S. and Malumphy, C. (2009). Fruit 

flies (Diptera: Tephritidae) intercepted 

on plant produce imported into England 

and Wales. The Entomologist’s 

Monthly Magazine 145, 213-26. 

Shelly, T.E., Pahio, E. and Edu, J. (2004). 

Synergistic and inhibitory interactions 

between methyl eugenol and cue lure 

influence trap catch of male fruit flies, 

Bactrocera dorsalis (Hendel) and B. cucurbitae 

(Diptera: Tephritidae) Florida 

Entomologist 87, 481-6. 

Stanaway, M.A., Zalucki, M., Gillespie, 

P.S., Rodriguez, C.M. and Maynard, 

G.V. (2001). Pest risk assessment of insects 

in sea cargo containers. Australian 


Stephenson, B.P., Gill, G.S.C., Randall, J.L. 

and Wilson, J.A. (2003). Biosecurity approaches 

to surveillance and response 

for new plant pest species. New Zealand 

Plant Protection 56, 5-9. 

Umeya, K. and Hirao, J. (1975). Attraction 

of Jackfruit fly, Dacus umbrosus F. (Diptera: 

Tephritidae) and lace wing, Chrysopa 

sp. (Neuropteran: Chrysopidae) by 

lure traps baited with methyl eugenol 

and cue-lure in the Philippines. Japanese 

Society of Applied Entomology and Zoology 

10, 60-62. 

Vargas, R.I., Stark, J.D., Kido, M.H., Ketter, 

H.M. and Whitehand, L.C. (2000). 

Methyl eugenol and cue-lure traps for 

suppression of male oriental fruit flies 

and melon flies (Diptera: Tephritidae) 

in Hawaii: effects of lure mixtures and 

weathering. Journal of Economic Entomology 

93, 81-7. 

VSN International Ltd (2006). Genstat for 

Windows Release 9.2. Lawes Agricultural 

Trust. United Kingdom. 

VSN international Ltd (2010). Genstat for 

Windows Release 13.1. Lawes Agricultural 

Trust. United Kingdom. 

Weldon, C. and Meats, A. (2007). Shortrange 

dispersal of recently emerged 

males and females of Bactrocera tryoni 

(Froggatt) (Diptera: Tephritidae) monitored 

by sticky sphere traps baited with 

protein and Lynfield traps baited with 

cue-lure. Australian Journal of Entomology 

46, 160-6. 

Weldon, C. and Meats, A. (2010). Dispersal 

of mass-reared sterile, laboratory-domesticated 

and wild male Queensland 

fruit flies. Journal of Applied Entomology 

134, 16-25.

Plant Health Australia 

Suite 1/1 Phipps Close 

DEAKIN ACT 2600 

Phone: +61 2 6215 7700 

Email: admin@phau.com.au 

www.planthealthaustralia.com.au

National Fruit Fly Diagnostic Protocol - IPPC.int

You also want an ePaper? Increase the reach of your titles

Delete template?

Save as template?