Next Article in Journal
Full-Length Transcriptome Analysis of the Halophyte Nitraria sibirica Pall
Previous Article in Journal
Transcriptome Profile of Membrane and Extracellular Matrix Components in Ligament-Fibroblastic Progenitors and Cementoblasts Differentiated from Human Periodontal Ligament Cells
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Genes
Volume 13
Issue 4
10.3390/genes13040660
genes-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Comparative Analysis of Four Complete Mitochondrial Genomes of Epinephelidae (Perciformes)

by
Chen Wang
1,
Peiyuan Ye
1,2,
Min Liu
3,
Yue Zhang
1,
Haiqing Feng
1,
Jingyu Liu
1,
Haolang Zhou
4,
Junjie Wang
5,* and
Xiao Chen
1,4,*
1
College of Marine Sciences, South China Agriculture University, Guangzhou 510642, China
2
College of Marine Sciences, Shanghai Ocean University, Shanghai 201306, China
3
State Key Laboratory of Marine Environmental Science, College of Ocean and Earth Sciences, Xiamen University, Xiamen 361012, China
4
Guangxi Mangrove Research Center, Beihai 536000, China
5
Guangzhou Key Laboratory of Subtropical Biodiversity and Biomonitoring, School of Life Sciences, South China Normal University, Guangzhou 510631, China
*
Authors to whom correspondence should be addressed.
Genes 2022, 13(4), 660; https://doi.org/10.3390/genes13040660
Submission received: 1 March 2022 / Revised: 28 March 2022 / Accepted: 4 April 2022 / Published: 8 April 2022
(This article belongs to the Section Animal Genetics and Genomics)
Browse Figures
Versions Notes

Abstract

:
Groupers are commercial, mainly reef-associated fishes, classified in the family Epinephelidae (Perciformes). This study first sequenced the complete mitogenomes of Cephalopholis leopardus, Cephalopholis spiloparaea, Epinephelus amblycephalus, and Epinephelus hexagonatus. The lengths of the four Epinephelidae mitogenomes ranged from 16,585 base pair (bp) to 16,872 bp with the typical gene order. All tRNA genes had a typical cloverleaf structure, except the tRNA-Ser (AGY) gene which was lacking the entire dihydrouridine arm. The ratio of nonsynonymous substitution (Ka) and synonymous substitution (Ks) indicated that four groupers were suffering a purifying selection. Phylogenetic relationships were reconstructed by Bayesian inference (BI) and maximum likelihood (ML) methods based on all mitogenomic data of 41 groupers and 2 outgroups. The identical topologies result with high support values showed that Cephalopholis and Epinephelus are not monophyletic genera. Anyperodon and Cromileptes clustered to Epinephelus. Aethaloperca rogaa and Cephalopholis argus assembled a clad. Cephalopholis leopardus, C. spiloparaea, and Cephalopholis miniata are also in a clade. Epinephelus hexagonatus is close to Epinephelus tauvina and Epinephelus merra, and E. amblycephalus is a sister group with Epinephelus stictus. More mitogenomic data from Epinephelidae species are essential to understand its taxonomic status with the family Serranidae.

1. Introduction

Groupers, a clade containing many commercial species, have long been classified as a subfamily to the family Serranidae (Perciformes) and common hinds including 234 species in 32 genera [1,2]. Craig et al. revised the classification of groupers based on genetic data [3,4]. The family Epinephelidae which includes 16 genera was officially proposed [5,6] and a growing stream of research prefers to accept this view [7,8,9]. However, the subfamily Epinephelinae is still used in a few recent studies [2,10]. This has caused great obstacles to the survey and conservation of grouper resources, and signifies that the classification status of Epinephelidae merits further investigation [3,11]. In addition, with the significant increase in catches and the aggravation of marine environmental pollution, the living conditions of groupers have been greatly threatened. Some grouper species (20 species to be exact) have even been listed as Critically Endangered (CR), endangered species (EN), or Vulnerable species (VU) by the International Union for Conservation of Nature (IUCN) [12].
Molecular biology has been applied to the studies on the classification and phylogeny of fishes and has solved some taxonomic problems [13]. Based on traditional morphology, the genus Cephalopholis should be classified as a subgenus of Epinephelus, however, many related studies have refuted this view and suggested that the genus should be an independent genus at both morphological and molecular levels [3,14]. The evolutionary biology of groupers has been widely studied by researchers, but the current understanding of the structure, evolution, characteristics, and properties of groupers’ mitogenomes is quite limited. To fill the gap in genetic information, this study analyzes the phylogeny and evolutionary histories of Epinephelidae based on the newly complete mitogenomes of four studied groupers with the published Epinephelidae data.
Cephalopholis leopardus (Lacepède, 1801) has a continuous dorsal fin with IX spines and 13 to 15 rays, and a pinkish-brown flat body with dense red-orange or pinkish red spots [15,16]. Cephalopholis spiloparaea (Valenciennes, 1828) is similar to the C. leopardus in appearance, except C. spiloparaea has 14 to 16 rays on the dorsal fin [15]. Epinephelus amblycephalus (Bleeker, 1857) and Epinephelus hexagonatus (Forster, 1801) are easier to distinguish in appearance. The E. hexagonatus is pale grey covered with hexagonal spots while E. amblycephalus has five broad dark brown bars; another difference is that the dorsal fin of E. hexagonatus and E. amblycephalus have 15 to 16 rays and 15 to 17 rays, respectively [4,5]. Genus Cephalopholis (Bloch and Schneider, 1801) was transitorily resurrected from the synonymy of Epinephelus species (Bloch, 1793) where it had lain dormant since its original description in 1801 [17]. As a valid genus, Cephalopholis was widely used and demoted to subgeneric status, but in subsequent publications it has again been recognized as the Cephalopholis genus [18,19]. Recognition of Cephalopholis as either a genus or subgenus is a demonstrated point, and Cephalopholis is a convenient taxon that is readily separable from other genera of groupers [20]. The genus Cephalopholis belongs to the family Epinephelidae, mainly distributed in the Indo Pacific region, with one dorsal fin with IX spines and 13 to 17 rays. The C. spiloparaea is similar to C. leopardus in shape and has IX spines, 14 to 16 rays, and 13 to 15 rays on its dorsal fin. Different from the genus Cephalopholis, Epinephelus species have a continuous dorsal fin with XI spines and 15 to 17 rays, which is oblong, flat, and stout, and is generally found near coral or rocky reefs in depths of 10 to 200 m around the Indo Pacific region [1].
Generally, the fish mitochondrial genome (mitogenome) is a circular, covalently closed double-stranded DNA molecule, which has maternal inheritance, conserved gene arrangement, and a high evolutionary rate [21,22]. Hence, it is considered to have an evolutionary origin independent of nuclear DNA. The length of the mitogenome is 15–20 kb, usually comprising 13 protein-coding genes (PCGs), 22 transfer RNA genes (tRNAs), 2 ribosomal RNA genes (rRNAs), 1 light-strand origin of replication (OL), and 1 control region (D-loop) [22]. There are some evolutionary studies focusing on Epinephelidae using mitogenome analysis [4], but the phylogenetic problems of Epinephelidae remain unclear because the evolutionary history is still not completely understood. In the present study, we first describe four complete mitogenomes of Epinephelidae (Cephalopholis leopardus, Cephalopholis spiloparaea, Epinephelus amblycephalus, and Epinephelus hexagonatus), providing potential markers for population genetic studies.

2. Materials and Methods

2.1. DNA Extraction, Amplification, and Sequencing

Multiple specimens of four groupers were collected from four sites (Weizhou Dao, Huayang Jiao, Yongshu Jiao, and Zhubi Jiao) in the South China Sea, China (Figure 1, Table 1). The tissue samples of the four studied species were collected and immediately deposited in 95% alcohol, then stored at −20 °C. Genomic DNA was extracted from the gill using the Marine Animal Tissue Genomic DNA Extraction Kit (Qiagen, Beijing, China). The 2 × EasyTaq® PCR SuperMix (Takara Biomedical Technology, Beijing, China) was used to amplify the segments using a long polymerase chain reaction (PCR) and primer walking method [23]. The parameters of the PCR reactions were followed the manufacturer’s recommendations to amplify DNA. The nine long fragments were separated from the complete mitogenomes of groupers with optimized universal primers of Epinephelidae mitogenome designed by Zhuang [24]. Then, the fragments of mitogenomes were obtained by sanger sequencing.

2.2. Sequence Assembly, Annotation, and Analysis

Sequence data were compiled to create four complete mitogenomes using the DNAStar v7.1 program [25]. Each species was identified by morphological identification and COI and Cytb genes were identified by Blast (https://blast.ncbi.nlm.nih.gov/Blast.cgi accessed on 12 December 2021). The four studied mitogenomes were first annotated with MITOS2 Web Server [26]. Then, tRNAs’ secondary structures were identified by online tRNAscan-SE Search Server v2.0 (Washington University School of Medicine, St Louis, MO, USA) [27], and further confirmed by ARWEN v1.2 online by default search mode [28]. Annotation and accurate boundary determination of PCGs and rRNAs genes were manually aligned and compared with the other released mitogenomes of Epinephelidae species using DNAman v6 software (Lynnon Biosoft, San Ramon, CA, USA) [29].
The mitogenomes of the four groupers were visualized into complete circular genomes by the CGView Server v1.0 (Figure 2) [30]. The base compositions, codon usage, and relative synonymous codon usage (RSCU) values were calculated in the MEGA X program (Tokyo Metropolitan University, Tokyo, Japan) [31]. The map was drawn using ggblot2 by Rstudio [32]. Nucleotide diversity (Pi) of the PCGs in the four studied Epinephelidae mitogenomes were calculated with DnaSP v6 (Universitat de Barcelona, Barcelona, Spain) [33]. Non-synonymous substitution (Ka) and synonymous substitution (Ks) mutation rate ratios were performed by KaKs_Calculator 2.0 program [34]. The following formulas was used to measured strand asymmetry of the basis: AT skew = [(A − T)/(A + T)] and GC skew = [(G − C)/(G + C)] [35].

2.3. Phylogenetic Analysis

Phylogenetic analyses were conducted using the four newly sequenced mitogenomes and 43 Epinephelidae species available in the National Center of Biotechnology Information (NCBI) (https://www.ncbi.nlm.nih.gov/, accessed on 30 December 2021) (Table S1). Lates japonicus (NC_034339) and Pagrus major (NC_003196) were used as outgroups. All DNA sequences of 12 H-strand coded protein genes and two rRNAs were aligned by the MACSE v.2.03 (http://mbb.univ-montp2.fr/macse, accessed on 30 December 2021) and MAFFT program [36,37], respectively. The alignments of 12 PCGs (except the start and stop codon) were extracted from the first and the second codon. Then, ambiguously aligned fragments of rRNAs were removed using Gblocks 0.91b (accessed on 30 December 2021) [38]. A dataset was comprised by concatenating the above three segments by Phylosuite v1.2.2 (Bio-Transduction Lab, Wuhan, China) [39].
The ModelFinder lugin integrated into PhyloSuite was used to select the best-fit partition model with the greedy algorithm [40]. GTR + F + I + G4 was selected as the optimal model for the three partitions, according to the Akaike information (AICc) criterion [41]. Phylogenetic analyses were performed using the ML and BI analyses methods, using IQ-TREE v1.6.2 software (Medical University of Vienna, Vienna, Austria) under 10,000 ultrafast bootstraps with the approximate Bayes test and MrBayes 3.2.6 program (University of California, La Jolla, San Diego, CA, USA) under two parallel runs and 2,000,000 generations [42,43]. The phylogenetic trees dataset files were used to visualize and annotate the phylograms using the online iTOL v6 platform [44], embellished by Adobe Illustrator CS6 software (Adobe Systems Incorporated, San Jose, CA, USA).

3. Results and Discussion

3.1. Genome Organization and Base Composition

The lengths of C. leopardus, C. spiloparaea, E. amblycephalus, and E. hexagonatus mitogenomes were 16,585 bp, 16,587 bp, 16,869 bp, and 16,872 bp, respectively (Table 1), and within the range of the other 37 published mitogenomes of groupers from 16,389 bp (Epinephelus latifasciatus) to 17,227 bp (Epinephelus bleekeri) (Table S1). The gene content of the four species was similar to the most well-known mitogenomes of groupers, including 13 PCGs, 22 tRNAs, 2 rRNAs, 1 control region (CR), and the origin of L-strand replication (OL) (Figure 2, Table 2). Eight tRNA (tRNA-Ala, tRNA-Cys, tRNA-Glu, tRNA-Asn, tRNA-Pro, tRNA-Gln, tRNA-Ser (TGA), and tRNA-Tyr) and ND6 genes were located on the light strand (L-strand), while other genes (12 PCGs, 14 tRNAs, 2 rRNAs, and 1 D-loop) were encoded on the heavy strand (H-strand). The size and location of each gene were similar in Cephalopholis and Epinephelus; the lengths of Cephalopholis mitogenomes presented only two bp differences, and only three bp differences in Epinephelus.
According to the base composition, the AT content of the C. leopardus, C. spiloparaea, E. amblycephalus, and E. hexagonatus mitogenomes were 55.2%, 55.3%, 54.8%, and 55.0%, respectively. There is less variation in nucleotide composition among the mitogenomes of the four groupers; all showed a higher AT content than GC content (Figure 3a). The AT-skews of the complete mitogenomes among four groupers are positive, while the GC-skews are all negative (Figure 3b). Except for the ND6 gene, the AT-skews of 12 L-strand PCGs are more positive than GC-skews. These results show that the A content is higher than T, and the C content is higher than the G content for studied mitogenomes. The mitogenomes of the four species were found to be enriched in G and T bases in the H-strand and A and C bases in the L-strand. In the ND6 gene, the GC-skew value is completely opposite to 12 H-strand PCGs, a phenomenon commonly found in vertebrates [45].

3.2. Protein Coding Genes and Codon Usage

Similar to other fish, PCGs of the mitogenomes of four groupers were encoded on the H-strand, except for the ND6 gene that is located on the L-strand. The length of PCGs ranged from 11,406 bp (E. hexagonatus) to 11,430 bp (C. leopardus and C. spiloparaea). The majority of the PCGs were initiated with ATG or GTG (COI gene), but ATP6 of the four groupers started with CTG, different from most other teleost and similar to the published mitogenomes of Epinephelidae (Table S1). All PCGs of the studied groupers use the typical TAA (includes the abbreviated T- form) stop codons. As the typical termination codon in many mitogenomes, TAG is not used frequently by the PCGs among the four groupers. The 12 PCGs encoded by the H-strand displayed T rich, while the ND6 gene located in the L-strand displayed T rich (Figure 3a,b).
The codon usage of PCGs is 3793 in E. hexagonatus and 3800 in the other three species. The frequent amino acids in the PCGs of the four studied mitogenomes were Leucine (Leu) and Alanine (Ala), visualized in Figure 4, similar to those being used in other Epinephelidae mitogenomes. In addition, the minimally used amino acid in the four groupers’ mitogenomes was Cysteine (Cys). At the same time, the relative synonymous codon usage (RSCU) values of four studied mitogenomes were calculated and visualized (Figure 5). The result showed that the third codons were biased to use A and T rather than C and G in the four groupers.
In the thirteen PCGs of the four studied mitogenomes, Leu (CUU, CUC, CUA, and CUG) and Ala (GCU, GCC, GCA, and GCG) were the most abundant amino acids, and Cys (UGU and UGC) and Arg (CGU, CGC, CGA, and CGG) were rarely used. The RSCU is usually used to assess the synonymous codon usage bias. The RSCU showed that the codons end in A or T, more than G or C, similar to other fish mitogenomes [46]. Generally, codon usage was related to the gene expression level, the function of encoded proteins, tRNA abundance, and base composition [47,48,49,50,51]. Overall, the length, RSCU, skewness, and AT content of 13 PCGs in the Genus Cephalopholis and Epinephelus mitogenomes were nearly identical (Figure 3, Figure 4 and Figure 5). This means that the four studied groupers might be related to natural selection.

3.3. Sliding Window Analysis and Nucleotide Diversity

To reveal the evolutionary pattern of the PCGs, the Ka/Ks and nucleotide diversity of the four studied mitogenomes were calculated for the aligned thirteen PCGs. Nucleotide diversity was analyzed with a sliding window of the four studied groupers (Figure 6). The plot of sequence variation ratio exhibited highly variable nucleotide diversity among the four sequences, with nucleotide diversity values for the 100 bp windows ranging from 0.038 to 0.387. The nucleotide diversity values of most genes were similar. The COII gene had the lowest nucleotide diversity of 0.121, and the ND6 gene had significantly higher nucleotide diversity (0.288) than other genes.
As a universal indicator, Ka/Ks, the ratio of nonsynonymous substitution (Ka) and synonymous substitution (Ks), is usually used to assess selective pressure, even evolutionary relationships between different species in molecular studies [52,53,54]. Generally, Ka/Ks < 1, Ka/Ks = 1, and Ka/Ks > 1 were represented by the purifying selection, neutral mutation, and positive selection, respectively [55]. Ka/Ks ratios were estimated to investigate the evolutionary rates of all 13 PCG genes. The Ka/Ks ratio of all PCGs was less than 0.30, which indicated that the four sequences had a high similarity. The ATP8 and ND6 genes exhibited relaxed purifying selection, while other PCGs were under the strongest purifying selection (Figure 7). The ratio of Ka and Ks is the representative parameter of selective pressure magnitude and direction [56]. It indicated that four groupers were suffering a purifying selection. Among the 13 PCG genes, the average Ka/Ks ratio is higher in ND6 and ATP8 genes, implying they are under less purifying selection, similar to the mitogenomes of vertebrates and mollusks [57].

3.4. Transfer RNA and Ribosomal RNA Genes

Similar to the typical set of tRNA genes in Epinephelidae mitogenomes, all 22 standard tRNAs were found with high AT content (55.4–56.9%). However, the DHU stem was extremely conserved [7]. The length of tRNAs was similar to the four grouper mitogenomes, ranging from 1561 bp (E. amblycephalus) to 1565 bp (C. spiloparaea), and AT content was higher than GC content (Figure 3a,c). All tRNA (all four groupers compared simultaneously) varied in length from 67 bp (tRNA-Cys) to 76 bp (tRNA-Leu). There were two tRNA-Leu and tRNA-Ser among the twenty-two predicted tRNA genes from the four groupers (Table 2). All the predicted tRNAs displayed the typical cloverleaf secondary structure, except for tRNA-Ser (AGY), which cannot form a stable secondary structure because of the lack of the DHU arm; this structure was common among grouper mitogenomes [7]. The secondary cloverleaf structures of tRNA-Ser (AGY) genes identified in the mitogenome of the four groupers are shown in Figure 8.
The mitogenomes of the four groupers had one 12S rRNA and one 16S rRNA gene, located between tRNA-Phe and tRNA-Val, and between tRNA-Val and tRNA-Leu (UUR), respectively. Among four groupers, the size of 12S rRNAs ranged from 952 bp (E. amblycephalus) to 956 bp (E. hexagonatus), and 16S rRNAs ranged from 1705 bp (C. spiloparaea) to 1710 bp (E. amblycephalus and E. hexagonatus) in length. The two rRNAs were both encoded by the H-strand, a moderate nucleotide compositional with more AT content (53.0–53.6%) than GC content (46.4–47.1%), which is shown in Figure 3a.

3.5. Non-Coding Region

The non-coding regions in the mitogenomes of the four groupers include the CR, OL, and several short intergenic spacers. The intergenic spacers included the non-coding (NC) sequence and overlap region. The NCs ranged from 1 to 20 bp in size. The CR is the largest of these non-coding regions in which the groupers’ mitogenomes were located between tRNA-Pro and tRNA-Phe in the mitogenome of groupers, ranging from 880 bp (C. leopardus and C. spiloparaea) to 1172 bp in E. hexagonatus. The base composition of CR with AT rich ranged from 64.1% (C. spiloparaea) to 69.0% (E. amblycephalus). The length of the CR is variable, which is the main reason for the differences in the mitogenome lengths in fishes. The CR of all studied species’ mitogenomes showed positive AT-skew values while all control regions of the four grouper species displayed negative GC-skew values.
The OL of the four studied mitogenomes commonly lies between tRNA-Asn and tRNA-Cys with the length ranging from 34 bp (C. spiloparaea) to 44 bp (E. amblycephalus). Four of the studied groupers shared common features of the vertebrate OL, a pyrimidine rich 5′ flanking region of the stem (Table 3), similar to the published Epinephelidae mitogenomes. In addition, the length of nine overlap regions in two Cephalopholis ranged from one to 10 bp, and the genus Epinephelus had seven overlap regions from one to 16 bp in size.

3.6. Phylogenetic Analysis

To further investigate the phylogenetic relationships of the family Epinephelidae, phylogenetic trees were conducted with the concatenated mitogenomic sequences of 47 groupers and 2 outgroups. Phylogenetic analyses based on both Maximum Likelihood (ML) and Bayesian analyses (BI) methods revealed identical topologies, which also generally agreed with those presented in previous studies. The high nodal support value topologies of the two methods were shown by high bootstraps (left) and posterior probabilities (right) values (Figure 9). Contrary to the traditional classification, the molecular phylogenetic tree showed three clades of Epinephelus species, and the genera Cephalopholis and Epinephelus are not monophyletic groups. Genera Anyperodon and Cromileptes clustered to Epinephelus species as sister groups rather than only genus Epinephelus. Epinephelus hexagonatus is close to E. tauvina and E. merra, and E. amblycephalus is a sister group of E. stictus. Cephalopholis leopardus, C. spiloparaea, and C. miniata are located in a clade far away from Epinephelus species. Except for Aethaloperca rogaa and C. argus assembling a clad, the other Cephalopholis species are assumed to be a monophyletic group and close to the genus Variola. In addition, Triso dermopterus is a sister group to the Hyporthodus species, and close to the genera Cephalopholis and Epinephelus.
To test classifications on the mitogenome level, identical topologies of the two methods were produced by high nodal support values. The results showed that the genus Cephalopholis and Epinephelus are not monophyletic groups; this result was also seen by the non-monophyly of two grouper genera using the mitochondrial 16S rRNA gene by Craig [3]. The phylogenetic tree showed that the location of the two grouper genera was far, and Cephalopholis species should be elevated from the subgenus Cephalopholis to the genus Cephalopholis [1]. The taxonomic status of the Cephalopholis and Epinephelus genus is well supported by the results of a phylogenetic tree, consistent with previous studies [7,58,59]. In addition, the genera Aethaloperca, Anyperodon, Cromileptes, Cephalopholis, Epinephelus, Hyporthodus, Triso, Plectropomus, and Variola clustered with a strong monophyletic branch, which is consistent with the new classification of Epinephelidae [5,6]. The present study will greatly improve our understanding of the evolution profile and phylogenetic position in the family Epinephelidae.

4. Conclusions

Epinephelidae is a large family including 9 genera with at least 160 recognized species [5,6]. There are only 43 published whole mitogenome sequences of Epinephelidae in NCBI, 2022. The complete mitogenomes of four groupers which were first identified and compared in this study could increase the essential molecular data of Epinephelidae. The length of the mitogenomes of C. leopardus, C. spiloparaea, E. amblycephalus, and E. hexagonatus ranged from 16,585 bp, 16,587 bp, 16,869 bp, and 16,872 bp, respectively. The genomic structure of four groupers’ mitogenomes is conserved and similar to vertebrates, with typical gene order and few differences. Moreover, the AT-skew of the rRNAs was strongly positive whereas the GC-skew was slightly negative, showing that the contents of A and C were higher than those of T and G in the rRNAs among four groupers, respectively.
Due to growth characteristics in groupers, only morphological identification is prone to error. The mitogenome has been used as an effective tool for phylogenetic and population genetic analyses in fish. The insufficient number of species could cause questionable phylogenetic results; more grouper species will be needed in molecular studies for further investigation [60,61].

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/genes13040660/s1, Table S1: Detailed information on the analyzed species in this study.

Author Contributions

Conceptualization, methodology, validation, X.C.; software, formal analysis, writing—original draft preparation, C.W.; investigation, resources, data curation, P.Y.; writing—review and editing, M.L.; visualization, Y.Z. and H.F.; supervision, J.L. and H.Z.; project administration, funding acquisition, J.W. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the Guangxi Key Research and Development Programme funding (AB19245045), the National Natural Science Foundation of China (41666008), and the Natural Science Foundation of Guangxi Province (2016GXNSFDA380035). The APC was funded by Z.H.

Institutional Review Board Statement

The animal study protocol was approved by the Institutional Ethics Committee of South China Agriculture University (No: 2022G002).

Informed Consent Statement

Not applicable.

Data Availability Statement

Not applicable.

Acknowledgments

Thanks to Sheng Gao for his assistance in collecting fish samples.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Heemstra, P.C.; Randall, J.E. FAO Species Catalogue. Groupers of the World (Family Serranidae, Subfamily Epinephelinae). An Annotated and Illustrated Catalogue of the Grouper, Rockcod, Hind, Coral Grouper and Lyretail Species Known to Date. FAO Fish. Synop. 1993, 125, 1–382. [Google Scholar]
  2. Nelson, J.S.; Grande, T.C.; Wilson, M.V. Fishes of the World, 5th ed.; John Wiley & Sons: Hoboken, NJ, USA, 2016; pp. 1–752. [Google Scholar]
  3. Craig, M.T.; Pondella, D.J.; Franck, J.P.; Hafner, J.C. On the status of the Serranid fish genus Epinephelus: Evidence for paraphyly based upon 16S rDNA sequence. Mol. Phylogenet. Evol. 2001, 19, 121–130. [Google Scholar] [CrossRef] [PubMed]
  4. Craig, M.T.; Hastings, P.A. A molecular phylogeny of the groupers of the subfamily Epinephelinae (Serranidae) with a revised classification of the Epinephelini. Ichthyol. Res. 2007, 54, 1–17. [Google Scholar] [CrossRef]
  5. Craig, M.T.; de Mitcheson, Y.S.; Heemstra, P.C. Groupers of the World: A Field Market Guide; National Inquiry Services Centre: Grahamstown, South Africa, 2011; pp. 1–47. [Google Scholar]
  6. Ma, K.Y.; Craig, M.T. An Inconvenient Monophyly: An Update on the Taxonomy of the Groupers (Epinephelidae). Copeia 2018, 106, 443–456. [Google Scholar] [CrossRef]
  7. Zhuang, X.; Qu, M.; Zhang, X.; Ding, S. A comprehensive description and evolutionary analysis of 22 grouper (perciformes, epinephelidae) mitochondrial genomes with emphasis on two novel genome organizations. PLoS ONE 2013, 8, e73561. [Google Scholar] [CrossRef] [Green Version]
  8. Luiz, O.J.; Woods, R.M.; Madin, E.M.; Madin, J.S. Predicting IUCN extinction risk categories for the world’s data deficient groupers (Teleostei: Epinephelidae). Conserv. Lett. 2016, 9, 342–350. [Google Scholar] [CrossRef]
  9. Vaini, J.O.; Mota, K.G.; Ojeda, A.P.; Barreiros, J.P.; Moreira, R.G.; Hilsdorf, A.W. Development and characterization of 20 polymorphic microsatellite markers for Epinephelus marginatus (Lowe, 1834) (Perciformes: Epinephelidae) using 454 pyrosequencing. Genet. Mol. Biol. 2019, 42, 74–79. [Google Scholar] [CrossRef]
  10. Betancur, R.R.; Wiley, E.O.; Arratia, G.; Acero, A.; Bailly, N.; Miya, M.; Lecointre, G.; Orti, G. Phylogenetic classification of bony fishes. BMC Evol. Biol. 2017, 17, 162. [Google Scholar] [CrossRef] [Green Version]
  11. Tucker, S.J.; Kurniasih, E.M.; Craig, M.T. A New Species of Grouper (Epinephelus; Epinephelidae) from the Indo-Pacific. Copeia 2016, 104, 658–662. [Google Scholar] [CrossRef]
  12. De Mitcheson, Y.S.; Craig, M.T.; Bertoncini, A.A.; Carpenter, K.E.; Cheung, W.W.L.; Choat, J.H.; Cornish, A.S.; Fennessy, S.T.; Ferreira, B.P.; Heemstra, P.C.; et al. Fishing groupers towards extinction: A global assessment of threats and extinction risks in a billion dollar fishery. Fish Fish. 2013, 14, 119–136. [Google Scholar] [CrossRef]
  13. Liu, Z.J.; Cordes, J.F. DNA marker technologies and their applications in aquaculture genetics. Aquaculture 2004, 238, 1–37. [Google Scholar] [CrossRef]
  14. Baldwin, C.C.; Johnson, G.D. Phylogeny of the epinephelinae (Teleostei: Serranidae). Bull. Mar. Sci. 1993, 51, 240–283. [Google Scholar]
  15. Myers, R.F. Micronesian Reef Fishes: A Comprehensive Guide to the Coral Reef Fishes of Micronesia, 3rd revised and expanded ed.; Coral Graphics: Barrigada, Guam, 1999; p. 297. [Google Scholar]
  16. Allen, G.R.; Erdmann, M.V. Reef Fishes of the East Indies; Universitiy of Hawai’i Press, Tropical Reef Research: Perth, Australia, 2012; Volume I–III. [Google Scholar]
  17. Jordan, D.S.; Evermann, B.W. The Aquatic Resources of the Hawaiian Islands: The Shore Fishes of the Hawaiian Islands, with a General Account of the Fish Fauna; US Government Printing Office: Washington, DC, USA, 1905; Volume 23.
  18. Smith, C.L. A revision of the American groupers: Epinephelus and allied genera. Bull. Am. Mus. Nat. Hist. 1971, 146, 1–241. [Google Scholar]
  19. Smith, C.L. Family Serranidae. In FAO Species Identification Sheets for Fishery Purposes, Eastern Central Altantic; Fishing Area 34, 47 (In Part). Fischer, W., Bianchi, G., Scott, W.B., Eds.; Department of Fisheries and Oceans Canada by Arrangement with Food and Agricultural Organization of the United Nations: Ottawa, ON, Canada, 1981; Volumes 1–7. [Google Scholar]
  20. Smith-Vaniz, W.F.; Johnson, G.D.; Randall, J.E. Redescription of Gracila albomarginata (Fowler and Bean) and Cephalopholis polleni (Bleeker) with comments on the generic limits of selected Indo-Pacific groupers (Pisces: Serranidae: Epinephelinae). Proc. Acad. Nat. Sci. Phila. 1988, 140, 1–23. [Google Scholar]
  21. Wolstenholme, D.R. Animal Mitochondrial DNA: Structure and Evolution. Int. Rev. Cytol. 1992, 141, 173–216. [Google Scholar] [PubMed]
  22. Boore, J.L. Animal mitochondrial genomes. Nucleic Acids Res. 1999, 27, 1767–1780. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  23. Miya, M.; Nishida, M. Organization of the Mitochondrial Genome of a Deep-Sea Fish, Gonostoma gracile (Teleostei: Stomiiformes): First Example of Transfer RNA Gene Rearrangements in Bony Fishes. Mar. Biotechnol. 1999, 5, 416–426. [Google Scholar] [CrossRef]
  24. Zhuang, X.; Ding, S.X.; Wang, J.; Wang, Y.; Su, Y. A set of 16 consensus primer pairs amplifying the complete mitochondrial genomes of orange-spotted grouper (Epinephelus coioides) and Hong Kong grouper (Epinephelus akaara). Mol. Ecol. Resour. 2009, 9, 1551–15533. [Google Scholar] [CrossRef]
  25. Burland, T.G. DNASTAR’s Lasergene sequence analysis software. Methods Mol. Biol. 2000, 132, 71–91. [Google Scholar]
  26. Bernt, M.; Donath, A.; Juhling, F.; Externbrink, F.; Florentz, C.; Fritzsch, G.; Putz, J.; Middendorf, M.; Stadler, P.F. MITOS: Improved de novo metazoan mitochondrial genome annotation. Mol. Phylogenet. Evol. 2013, 69, 313–319. [Google Scholar] [CrossRef]
  27. Lowe, T.M.; Chan, P.P. tRNAscan-SE On-line: Integrating search and context for analysis of transfer RNA genes. Nucleic Acids Res. 2016, 44, 54–57. [Google Scholar] [CrossRef] [PubMed]
  28. Laslett, D.; Canback, B. ARWEN: A program to detect tRNA genes in metazoan mitochondrial nucleotide sequences. Bioinformatics 2008, 24, 172–175. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  29. Wang, W. The Molecular Detection of Corynespora Cassiicola on Cucumber by PCR Assay Using DNAman Software and NCBI. In Proceedings of the Computer and Computing Technologies in Agriculture IX, Beijing, China, 27–30 September 2015; pp. 248–258. [Google Scholar]
  30. Grant, J.R.; Stothard, P. The CGView Server: A comparative genomics tool for circular genomes. Nucleic Acids Res. 2008, 36, 181–184. [Google Scholar] [CrossRef] [PubMed]
  31. Kumar, S.; Stecher, G.; Li, M.; Knyaz, C.; Tamura, K. MEGA X: Molecular Evolutionary Genetics Analysis across Computing Platforms. Mol. Biol. Evol. 2018, 35, 1547–1549. [Google Scholar] [CrossRef]
  32. Wickham, H. Ggplot2: Elegant Graphics for Data Analysis, 2nd ed.; Springer International Publishing: Cham, Switzerland, 2016. [Google Scholar]
  33. Rozas, J.; Ferrer-Mata, A.; Sanchez-DelBarrio, J.C.; Guirao-Rico, S.; Librado, P.; Ramos-Onsins, S.E.; Sanchez-Gracia, A. DnaSP 6: DNA Sequence Polymorphism Analysis of Large Data Sets. Mol. Biol. Evol. 2017, 34, 3299–3302. [Google Scholar] [CrossRef]
  34. Wang, D.; Zhang, Y.; Zhang, Z.; Zhu, J.; Yu, J. KaKs_Calculator 2.0: A Toolkit Incorporating γ-Series Methods and Sliding Window Strategies. Genom. Proteom. Bioinform. 2010, 8, 77–80. [Google Scholar] [CrossRef] [Green Version]
  35. Katoh, K.; Standley, D.M. Patterns of nucleotide composition at fourfold degenerate sites of animal mitochondrial genomes. J. Mol. Evol. 1995, 41, 353–358. [Google Scholar]
  36. Ranwez, V.; Douzery, E.J.P.; Cambon, C.; Chantret, N.; Delsuc, F. MACSE v2: Toolkit for the Alignment of Coding Sequences Accounting for Frameshifts and Stop Codons. Mol. Biol. Evol. 2018, 35, 2582–2584. [Google Scholar] [CrossRef]
  37. Katoh, K.; Standley, D.M. MAFFT multiple sequence alignment software version 7: Improvements in performance and usability. Mol. Biol. Evol. 2013, 30, 772–780. [Google Scholar] [CrossRef] [Green Version]
  38. Talavera, G.; Castresana, J. Improvement of phylogenies after removing divergent and ambiguously aligned blocks from protein sequence alignments. Syst. Biol. 2007, 56, 564–577. [Google Scholar] [CrossRef] [Green Version]
  39. Zhang, D.; Gao, F.; Jakovlić, I.; Zou, H.; Zhang, J.; Li, W.X.; Wang, G.T. PhyloSuite: An integrated and scalable desktop platform for streamlined molecular sequence data management and evolutionary phylogenetics studies. Mol. Ecol. Resour. 2020, 20, 348–355. [Google Scholar] [CrossRef] [PubMed]
  40. Kalyaanamoorthy, S.; Minh, B.Q.; Wong, T.K.F.; von Haeseler, A.; Jermiin, L.S. ModelFinder: Fast model selection for accurate phylogenetic estimates. Nat. Methods 2017, 14, 587–589. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  41. Burnham, K.P.; Anderson, D.R. Model Selection and Multimodel Inference: A Practical Information-Theoretic Approach; Springer: Berlin/Heidelberg, Germany, 2002. [Google Scholar]
  42. Minh, B.Q.; Schmidt, H.A.; Chernomor, O.; Schrempf, D.; Woodhams, M.D.; von Haeseler, A.; Lanfear, R. IQ-TREE 2: New Models and Efficient Methods for Phylogenetic Inference in the Genomic Era. Mol. Biol. Evol. 2020, 37, 1530–1534. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  43. Nylander, J.A.; Ronquist, F.; Huelsenbeck, J.P.; Nieves-Aldrey, J.L. Bayesian phylogenetic analysis of combined data. Syst. Biol. 2004, 53, 47–67. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  44. Letunic, I.; Bork, P. Interactive tree of life (iTOL) v3: An online tool for the display and annotation of phylogenetic and other trees. Nucleic Acids Res. 2016, 44, 242–245. [Google Scholar] [CrossRef]
  45. Anderson, S.; Bankier, A.T.; Barrell, B.G.; de Bruijn, M.H.; Coulson, A.R.; Drouin, J.; Eperon, I.C.; Nierlich, D.P.; Roe, B.A.; Sanger, F.; et al. Sequence and organization of the human mitochondrial genome. Nature 1981, 290, 457–465. [Google Scholar] [CrossRef]
  46. Wang, C.; Lai, T.; Ye, P.; Yan, Y.; Feutry, P.; He, B.; Huang, Z.; Zhu, T.; Wang, J.; Chen, X. Novel duplication remnant in the first complete mitogenome of Hemitriakis japanica and the unique phylogenetic position of family Triakidae. Gene 2022, 820, 146232. [Google Scholar] [CrossRef]
  47. Li, B.; Wang, H.; Yang, L.; Liu, S.; Zhuang, Z. Complete Mitochondrial Genome of Pseudocaranx dentex (Carangidae, Perciformes) Provides Insight into Phylogenetic and Evolutionary Relationship among Carangidae Family. Genes 2021, 12, 1234. [Google Scholar] [CrossRef]
  48. Gupta, S.K.; Majumdar, S.; Bhattacharya, T.K.; Ghosh, T.C. Studies on the relationships between the synonymous codon usage and protein secondary structural units. Biochem. Biophys. Res. Commun. 2000, 269, 692–696. [Google Scholar] [CrossRef]
  49. Moriyama, E.N.; Powell, J.R. Gene length and codon usage bias in Drosophila melanogaster, Saccharomyces cerevisiae and Escherichia coli. Nucleic Acids Res. 1998, 26, 3188–3193. [Google Scholar] [CrossRef] [Green Version]
  50. Moriyama, E.N.; Powell, J.R. Codon usage bias and tRNA abundance in Drosophila. J. Mol. Evol. 1997, 45, 514–523. [Google Scholar] [CrossRef] [PubMed]
  51. Carlini, D.B.; Chen, Y.; Stephan, W. The relationship between third-codon position nucleotide content, codon bias, mRNA secondary structure and gene expression in the drosophilid alcohol dehydrogenase genes Adh and Adhr. Genetics 2001, 159, 623–633. [Google Scholar] [CrossRef] [PubMed]
  52. Boore, J.L.; Medina, M.; Rosenberg, L.A. Complete sequences of the highly rearranged molluscan mitochondrial genomes of the Scaphopod Graptacme eborea and the bivalve Mytilus edulis. Mol. Biol. Evol. 2004, 21, 1492–1503. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  53. Dellaporta, S.L.; Xu, A.; Sagasser, S.; Jakob, W.; Moreno, M.A.; Buss, L.W.; Schierwater, B. Mitochondrial genome of Trichoplax adhaerens supports placozoa as the basal lower metazoan phylum. Proc. Natl. Acad. Sci. USA 2006, 103, 8751–8756. [Google Scholar] [CrossRef] [Green Version]
  54. Zhang, D.; Zou, H.; Wu, S.G.; Li, M.; Jakovlic, I.; Zhang, J.; Chen, R.; Li, W.X.; Wang, G.T. Three new Diplozoidae mitogenomes expose unusual compositional biases within the Monogenea class: Implications for phylogenetic studies. BMC Evol. Biol. 2018, 18, 133. [Google Scholar] [CrossRef] [Green Version]
  55. Yang, Z.; Bielawski, J.P. Statistical methods for detecting molecular adaptation. Trends Ecol. Evol. 2000, 15, 496–503. [Google Scholar] [CrossRef]
  56. Stenico, M.; Lloyd, A.T.; Sharp, P. Codon usage in Caenorhabditis elegans: Delineation of translational selection and mutational biases. Nucleic Acids Res. 1994, 22, 2437–2446. [Google Scholar] [CrossRef] [Green Version]
  57. Monnens, M.; Thijs, S.; Briscoe, A.G.; Clark, M.; Frost, E.J.; Littlewood, D.T.J.; Sewell, M.; Smeets, K.; Artois, T.; Vanhove, M.P.M. The first mitochondrial genomes of endosymbiotic rhabdocoels illustrate evolutionary relaxation of atp8 and genome plasticity in flatworms. Int. J. Biol. Macromol. 2020, 162, 454–469. [Google Scholar] [CrossRef]
  58. Liu, M.; Li, J.L.; Ding, S.X.; Liu, Z.Q. Epinephelus moara: A valid species of the family Epinephelidae (Pisces: Perciformes). J. Fish Biol. 2013, 82, 1684–1699. [Google Scholar] [CrossRef]
  59. Chen, X.; Chen, H.; Yang, W.; Lin, L.; Liu, M. Complete mitochondrial genome and the phylogenetic position of the brown-spotted grouper Epinephelus chlorostigma (Perciformes: Epinephelidae). Mitochondrial DNA A DNA Mapp. Seq. Anal. 2016, 27, 4268–4269. [Google Scholar] [CrossRef]
  60. Wang, C.; Chen, H.; Tian, S.; Yang, C.; Chen, X. Novel Gene Rearrangement and the Complete Mitochondrial Genome of Cynoglossus monopus: Insights into the Envolution of the Family Cynoglossidae (Pleuronectiformes). Int. J. Mol. Sci. 2020, 21, 6895. [Google Scholar] [CrossRef] [PubMed]
  61. Satoh, T.P.; Miya, M.; Mabuchi, K.; Nishida, M. Structure and variation of the mitochondrial genome of fishes. BMC Genom. 2016, 17, 719. [Google Scholar] [CrossRef] [PubMed] [Green Version]
Genes 13 00660 g001 550
Figure 1. Sample collection sites in South China Sea, China.
Figure 1. Sample collection sites in South China Sea, China.
Genes 13 00660 g001
Genes 13 00660 g002 550
Figure 2. Graphical maps of the mitogenomes of Cephalopholis leopardus, Cephalopholis spiloparaea, Epinephelus amblycephalus, and Epinephelus hexagonatus.
Figure 2. Graphical maps of the mitogenomes of Cephalopholis leopardus, Cephalopholis spiloparaea, Epinephelus amblycephalus, and Epinephelus hexagonatus.
Genes 13 00660 g002
Genes 13 00660 g003 550
Figure 3. Base composition (a), skewness (b), and gene length (c) of the complete mitogenomes of the four groupers.
Figure 3. Base composition (a), skewness (b), and gene length (c) of the complete mitogenomes of the four groupers.
Genes 13 00660 g003
Genes 13 00660 g004 550
Figure 4. The amino acid usage of the complete mitogenomes of the four groupers (a–d).
Figure 4. The amino acid usage of the complete mitogenomes of the four groupers (a–d).
Genes 13 00660 g004
Genes 13 00660 g005 550
Figure 5. Relative synonymous codon usage (RSCU) in the mitogenomes of Cephalopholis leopardus (a), Cephalopholis spiloparaea (b), Epinephelus amblycephalus (c) and Epinephelus hexagonatus (d) mitogenomes.
Figure 5. Relative synonymous codon usage (RSCU) in the mitogenomes of Cephalopholis leopardus (a), Cephalopholis spiloparaea (b), Epinephelus amblycephalus (c) and Epinephelus hexagonatus (d) mitogenomes.
Genes 13 00660 g005
Genes 13 00660 g006 550
Figure 6. Sliding window analysis based on thirteen PCGs among four groupers. The red line shows the value of nucleotide diversity in the sliding window analysis window size = 100 bp, step size = 25 bp. The length of the arrow represents the length of 13 PCGs.
Figure 6. Sliding window analysis based on thirteen PCGs among four groupers. The red line shows the value of nucleotide diversity in the sliding window analysis window size = 100 bp, step size = 25 bp. The length of the arrow represents the length of 13 PCGs.
Genes 13 00660 g006
Genes 13 00660 g007 550
Figure 7. The average non-synonymous (Ka) substitution rates (a), synonymous (Ks) substitution rates (b) and Ka/Ks (c) of 13 coding proteins among four species.
Figure 7. The average non-synonymous (Ka) substitution rates (a), synonymous (Ks) substitution rates (b) and Ka/Ks (c) of 13 coding proteins among four species.
Genes 13 00660 g007
Genes 13 00660 g008 550
Figure 8. The tRNA-Ser(AGY) in the mitogenomes of Cephalopholis leopardus (a), Cephalopholis spiloparaea (b), Epinephelus amblycephalus (c) and Epinephelus hexagonatus (d).
Figure 8. The tRNA-Ser(AGY) in the mitogenomes of Cephalopholis leopardus (a), Cephalopholis spiloparaea (b), Epinephelus amblycephalus (c) and Epinephelus hexagonatus (d).
Genes 13 00660 g008
Genes 13 00660 g009 550
Figure 9. The phylogenetic tree inferred from the nucleotide sequences of twelve H-strand PCGs (the first and second codons) and two rRNAs using the Bayesian inference (BI) and maximum likelihood (ML) methods. Numbers on branches indicate posterior probability (left) and bootstrap (right).
Figure 9. The phylogenetic tree inferred from the nucleotide sequences of twelve H-strand PCGs (the first and second codons) and two rRNAs using the Bayesian inference (BI) and maximum likelihood (ML) methods. Numbers on branches indicate posterior probability (left) and bootstrap (right).
Genes 13 00660 g009
Table
Table 1. Detailed information on the four analyzed Epinephelidae species.
Table 1. Detailed information on the four analyzed Epinephelidae species.
SpeciesGenBank Accession NumberSize (bp)AT%AT-SkewSampling IDSampling Year
Cephalopholis leopardusMW56046716,58555.20.06YS20180521072018
Cephalopholis spiloparaeaMW56046816,58755.30.06ZB20180508142018
Epinephelus amblycephalusOM37092916,87255.00.04WZ20181104102019
Epinephelus hexagonatusMW56046916,86954.80.04HY20190605082019
Table
Table 2. Features of the complete mitogenomes of four Epinephelidae.
Table 2. Features of the complete mitogenomes of four Epinephelidae.
GenesStrandSize (bp)Start CodonStop CodonAnticodon
Cephalopholis leopardus/Cephalopholis spiloparaea/Epinephelus amblycephalus/Epinephelus hexagonatus
tRNA-Phe (F)H70/69/70/70 GAA
12S rRNAH954/954/952/956
tRNA-Val (V)H71/71/70/71 TAC
16S rRNAH1709/1705/1710/1710
tRNA-Leu1 (L1)H75/76/76/75 TAA
ND1H975/975/975/975ATG/ATG/ATG/ATGTAA/TAA/TAA/TAA
tRNA-Ile (I)H70/70/70/70 TTG
tRNA-Gln (Q)L71/71/71/71 GAT
tRNA-Met (M)H69/69/69/69 CAT
ND2H1047/1047/1047/1047ATG/ATG/ATG/ATGTAA/TAA/TAA/TAA
tRNA-Trp (W)H71/71/71/71 TCA
tRNA-Ala (A)L69/69/69/69 TGC
tRNA-Asn (N)L73/73/73/73 GTT
OL-41/40/44/43
tRNA-Cys (C)L68/67/67/68 GCA
tRNA-Tyr (Y)L71/71/71/71 GTA
COIH1551/1551/1551/1551GTG/GTG/GTG/GTGTAG/TAA/TAA/TAG
tRNA-Ser1 (S1)L72/71/71/71 TGA
tRNA-Asp (D)H73/74/73/73 GTC
COIIH691/691/691/691ATG/ATG/ATG/ATGT-/T-/T-/T-
tRNA-Lys (K)H73/73/74/73 TTT
ATP8H168/168/168/168ATG/ATG/ATG/ATGTAA/TAA/TAA/TAA
ATP6H684/690/684/684CTG/CTG/CTG/CTGTAA/TAA/TAA/TAA
COIIIH786/786/786/786ATG/ATG/ATG/ATGTAA/TAA/TAA/TAA
tRNA-Gly (G)H72/72/72/72 TCC
ND3H351/349/349/351ATG/ATG/ATG/ATGTAG/T-/T-/TAG
tRNA-Arg (R)H69/69/69/69 TCG
ND4LH297/297/297/297ATG/ATG/ATG/ATGTAA/TAA/TAA/TAA
ND4H1381/1354/1381/1381ATG/ATG/GTG/ATGT-/T-/T-/T-
tRNA-His (H)H71/70/70/70 GTG
tRNA-Ser2 (S2)H72/71/70/72 GCT
tRNA-Leu2 (L2)H73/73/73/73 TAG
ND5H1839/1839/1839/1839ATG/ATG/ATG/ATGTAA/TAA/TAA/TAA
ND6L522/522/522/522ATG/ATG/ATG/ATGTAA/TAG/TAA/TAG
tRNA-Glu (E)L69/69/69/69 TTC
CytbH1141/1141/1141/1141ATG/ATG/ATG/ATGT-/T-/T-/T-
tRNA-Thr (T)H73/73/73/73 TGT
tRNA-Pro (P)L70/70/70/70 TGG
Control region (CR)H880/880/1170/1171
Table
Table 3. Detailed information of OL in four studied mitogenomes.
Table 3. Detailed information of OL in four studied mitogenomes.
SpeciesLength (bp)Sequence
Cephalopholis leopardus35TCCCCCGCCTAATAATAAGACTAATAGGCGGGGGA
Cephalopholis spiloparaea34TCCCCCGCCTAATAATAGGCTAATAGGCGGGGGA
Epinephelus amblycephalus44GCTTCCCCCCGCCCCCCGGGGGGCGGGGGGCGGCGGGGGGAAGC
Epinephelus hexagonatus39TCCCCCGCCTACTCAGATCCAAAAGGAGTAGGCGGGGGA
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Wang, C.; Ye, P.; Liu, M.; Zhang, Y.; Feng, H.; Liu, J.; Zhou, H.; Wang, J.; Chen, X. Comparative Analysis of Four Complete Mitochondrial Genomes of Epinephelidae (Perciformes). Genes 2022, 13, 660. https://doi.org/10.3390/genes13040660

AMA Style

Wang C, Ye P, Liu M, Zhang Y, Feng H, Liu J, Zhou H, Wang J, Chen X. Comparative Analysis of Four Complete Mitochondrial Genomes of Epinephelidae (Perciformes). Genes. 2022; 13(4):660. https://doi.org/10.3390/genes13040660

Chicago/Turabian Style

Wang, Chen, Peiyuan Ye, Min Liu, Yue Zhang, Haiqing Feng, Jingyu Liu, Haolang Zhou, Junjie Wang, and Xiao Chen. 2022. "Comparative Analysis of Four Complete Mitochondrial Genomes of Epinephelidae (Perciformes)" Genes 13, no. 4: 660. https://doi.org/10.3390/genes13040660

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop