A new order of red algae based on the Peyssonneliaceae, with an evaluation of the ordinal classification of the Florideophyceae (Rhodophyta)

David M. Krayesky; James N. Norris; Paul W. Gabrielson; Daniela Gabriel; Suzanne Fredericq

The red algae (Rhodophyta) form a distinct photosynthetic eukaryotic lineage that consists of around 6,000 species including unicellular to large multicellular taxa (http://www.algaebase.org/). The red algae are unique among eukaryotes in lacking both flagella and centrioles during their entire life cycle (Gabrielson et al., 1990; Graham and Wilcox, 2000). Pit connections, pit plugs, and a triphasic life cycle that are mostly found in the Florideophyceae are also distinguishing characters of the red algae. The photosynthetic organelle (plastid) of red algae is bounded by two membranes and contains chlorophyll-a, phycocyanin, and phycoerythrin as photosynthetic pigments. These pigment complexes, organized in phycobilisomes, are located on the surface of unstacked thylakoid membranes to capture light energy. As a storage product, the red algae produce granulated floridean starch in the cytoplasm that is different from green algal starch. In addition to these unique features, the monop...

PROCEEDINGS OF THE BIOLOGICAL SOCIETY OF WASHINGTON 122(3):364–391. 2009. A new order of red algae based on the Peyssonneliaceae, with an evaluation of the ordinal classification of the Florideophyceae (Rhodophyta) David M. Krayesky, James N. Norris*, Paul W. Gabrielson, Daniela Gabriel, and Suzanne Fredericq (DMK, DG, SF) Department of Biology, University of Louisiana at Lafayette, Lafayette, Louisiana 70504-2451, U.S.A.; (DMK) present address: Department of Biology, Slippery Rock University of Pennsylvania, Slippery Rock, Pennsylvania 16057, U.S.A., e-mail: david.krayesky@sru.edu, danielagabriel@gmail.com, & slf9209@louisiana.edu; (JNN) Department of Botany, MRC 166, National Museum of Natural History, Smithsonian Institution, Washington, D.C. 20013-7012, U.S.A., e-mail: norrisj@si.edu; (PWG) Herbarium, University of North Carolina at Chapel Hill, Chapel Hill, North Carolina 27599-3280, U.S.A., e-mail: drseaweed@hotmail.com Abstract.—The Peyssonneliaceae Denizot comprises a worldwide group of non-calcified or calcified, crust-forming red algae found in diverse, intertidal to deep subtidal marine habitats. Eight genera have been recognized in the family, with Peyssonnelia Decaisne having the largest number of species. Both comparative morphology and rbcL and nuclear LSU rDNA sequence data support the monophyly of the family and show that it cannot be maintained in the order Gigartinales Schmitz. A new order, Peyssonneliales, is herein proposed to accommodate the Peysonneliaceae, with only two of the genera (i.e., Peyssonnelia and Sonderopelta), and its relationship to the other red algal orders is discussed. We also propose the transfer of one species, Peyssonnelia capensis Montagne to Sonderopelta Womersley & Sinkora. The red algal family Peyssonneliaceae Denizot (1968) represents a diverse group of non-calcified and calcified crustose algae. Although some of the more heavily calcified species are superficially similar in habit to some of the crustose (nonarticulated) coralline algae (Corallinaceae, Corallinales), they differ markedly in the organization of their reproductive structures. In the Peyssonneliaceae, the reproductive structures are confined to nemathecia, which are external pustules that develop from simultaneous transverse division of surface cells forming a dome-shaped aggregation of assimilatory * Corresponding author. filaments (Denizot 1968). In contrast, no nemathecia are formed in members of the Corallinaceae, as an analogous structure, a sorus, contains the reproductive structures (Silva & Johansen 1986). Further differences between these groups include the ultrastructure of their pit-plugs (Pueschel 1989), and the mineral form of calcium carbonate as aragonite (Leliaert & Coppejans 2004:200) in the Peyssonneliaceae versus calcite in the Corallinaceae (Silva & Johansen 1986). Members of the Peyssonneliaceae occur in arctic, temperate, subtropical, and tropical waters worldwide. With nearly 100 non-calcified and calcified species, the family represents a model group for VOLUME 122, NUMBER 3 global biogeographic studies of red algae. Some of the more calcified members of the Peyssonneliaceae, along with crustose corallines, form algal nodules or rhodoliths (maërl) and act as substrata for the establishment of reef communities (Cabioch 1974, Littler et al. 1985, 1986; Foster et al. 1997, Rasser & Riegl 2002). Species of Peyssonnelia Decaisne (1841) occur from the intertidal to shallow subtidal and into deep-water habitats at depths of 200–288 m in the Bahamas, making them among the deepest occurring photosynthetic organisms (Littler et al. 1985, 1986). The Peyssonneliaceae is one of the few red algal families for which fossils are known; fossil evidence suggests that species of Peyssonnelia and Polystrata Heydrich (1905) were present 65 to 100 million years ago (Johnson 1964, James et al. 1988, Stockar 2001). The Peyssonneliaceae has a predominantly prostrate, crustose growth form that is generally arranged into two, or sometimes three, layers: a perithallus (upper cell layer more or less perpendicular to the basal hypothallus), and a hypothallus (lowermost cell layer, usually more or less parallel to the substratum); some taxa may also have a third layer, the mesothallus (middle layer). Denizot’s (1968) monograph of the Peyssonneliaceae included the genera Peyssonnelia and Cruoriella P. et H. Crouan (1859) and suggested that Polystrata may also be in this family. More recent studies have treated Cruoriella as a synonym of Peyssonnelia (e.g., Yoneshigue 1985, Maggs 1990, Womersley 1994, Guimarães & Fujii 1999). Taxonomic Placement of Peyssonnelia and the Peyssonneliaceae Currently eight genera are reported as belonging to the Peyssonneliaceae (Schneider & Wynne 2007), Peyssonnelia Decaisne; Polystrata Heydrich; Chevaliericrusta Denizot (1968); Riquetophycus De- 365 nizot (1968); Pulvinia Hollenberg (1970); Metapeyssonnelia Boudouresque, Coppejans et Marcot (1976); Ramicrusta D. R. Zhang et J. H. Zhou (1981); and Sonderopelta Womersley et Sinkora (1981). Of these genera, the most species-rich is Peyssonnelia, with more than 70 species worldwide (e.g., Kato & Masuda 2002, 2003; Ballantine & Aponte 2005; Ballantine & Ruı́z 2005, 2006). The Peyssonneliaceae (as the ‘‘Squamariaceae Zanardini’’) was originally placed in the Cryptonemiales F. Schmitz (1892). Schmitz (1883, 1892) defined red algal orders based on the comparative developmental morphology of reproductive structures and characterized the Cryptonemiales as a non-procarpic group. In the non-procarpic condition, auxiliary cells are scattered throughout the thallus and spatially removed from the egg cells (carpogonia). Long connecting filaments extend from the fertilized carpogonia and contact the auxiliary cells, resulting in the formation of sporebearing gonimoblasts of the carpospoprophyte generation. Subsequently, Kylin (1956) refined Schmitz’s classification system and distinguished six orders of Florideophycideae (Rhodophtya). Kylin defined the condition where the auxiliary cell forms a tight unit with the carpogonium, and the gonimoblast develops from the auxiliary cell upon its direct fusion with the fertilized carpogonium, as the procarpic condition (Silva & Johansen 1986). Kylin (1956, as ‘‘Squamariaceae’’) maintained Peyssonnelia in the family, within the Cryptonemiales F. Schmitz (see also discussions of Kraft & Robins 1985, Silva & Johansen 1986, Hommersand & Fredericq 1990). Two of the six orders recognized by Kylin (1956), the Gigartinales F. Schmitz (1892) and Cryptonemiales F. Schmitz (1892), were initially based on the origin and location of their generative auxiliary cells. Kylin (1932) placed algae in which auxiliary cells correspond to cells in 366 PROCEEDINGS OF THE BIOLOGICAL SOCIETY OF WASHINGTON ordinary vegetative filaments in the Gigartinales, whereas algae possessing auxiliary cells that are borne in filaments formed in addition to those of normal vegetative growth (‘‘accessory’’ filaments) in the Cryptonemiales. Phycologists have since questioned the validity of the auxiliary cell location as a taxonomic character alone to separate these two orders (e.g., Searles 1968). Kraft & Robins (1985) concluded that Kylin’s (1932, 1956) concept of the term ‘‘accessory’’ was artificial and proposed merging the two into a single large order, the Gigartinales, providing an opportunity to reevaluate taxonomic concepts in the Gigartinales sensu lato. Since the treatment of Kylin (1956) and the proposal of Kraft & Robins (1985), the concept of the GigartinalesCryptonemiales complex has changed, for example several families (i.e., Ahnfeltiaceae, Corallinaceae, Gracilariaceae, and Plocamiaceae), previously included in either order, have since been the basis for newly established orders (i.e., Ahnfeltiales, Corallinales, Gracilariales, and Plocamiales). Within the Gigartinales sensu lato (see below) there exist four morphologically diverse, non-procarpic families that are distinguished from other families in the order by their development of reproductive structures (gametangia or tetrasporangia) in nemathecia on separate individuals. These ‘‘nemathecial’’ families are: Polyidaceae Kylin (1956, as ‘‘Polyideaceae’’), Rhizophyllidaceae Schmitz (1892), Peyssonneliaceae Denizot, and Gainiaceae Moe (1985). The first three families were placed in the Cryptonemiales by Kylin (1956) on the basis of the accessory position of the auxiliary cell branch. Subsequently, Papenfuss (1966) and Wiseman (1975), respectively, transferred the Polyidaceae and Rhizophyllidaceae from the Cryptonemiales to the Gigartinales on grounds of the nonaccessory position of the auxiliary cell branch. The Peyssonneliaceae is currently placed in the Gigartinales (e.g., Saunders et al. 2004), whereas previous studies recognized the Peyssonneliaceae as belonging in the Cryptonemiales (e.g., Moe 1985, Schneider & Reading 1987). [A distinction is made herein between the Gigartinales sensu stricto (comprising only the Gigartinaceae and Phyllophoraceae), and the Gigartinales sensu lato (including the remaining families in the order, sensu Saunders et al. 2004).] The few molecular systematic investigations of the phylogenetic relationships of the Peyssonneliaceae to other members of the Class Florideophyceae included only a few taxa of Peyssonneliaceae, and none sampled included the generitype or specimens from the species’ type localities. Studies of Fredericq et al. (1996b), Harper & Saunders (2001), and Saunders et al. (2004) using, respectively, chloroplast-encoded rbcL, nuclear SSU rDNA and LSU rDNA sequences, implied that the Peyssonneliaceae is a monophyletic group that lacks support for any close relationships among or within the other orders of the Florideophyceae and suggested the family may best be placed in its own order. Phylogenetic analyses of rbcL data sets spanning a wide array of red algae at the family and ordinal rank (e.g., Fredericq et al. 1996b) revealed that the Peyssonneliaceae does not to belong in the complex comprising the Polyidaceae or Rhizophyllidaceae; instead the latter two families formed a well-supported clade with members of the Dumontiaceae and Kallymeniaceae (both non-nemathecial families traditionally placed in the Cryptonemiales). The purpose of this investigation is to test the taxonomic status of the Peyssonneliaceae, based on the type of the family and to elucidate the phylogenetic position of the family within the red algae (Rhodophyta), using chloroplast encoded rbcL, large subunit (LSU) rDNA, and comparative morphological data. Species of Peyssonnelia and Sonderopelta, includ- VOLUME 122, NUMBER 3 367 Table 1.—Newly designed oligonucleotide rbcL PCR and sequencing primers used in this study. Primer F40 F52 F709 R471 R851.1 R1434 Sequence 59 59 59 59 59 59 CGTTATGAGTCAGGTGTAATTCC TCAGGTGTAATTCCATATGC GGTGAAGTTAAAGGTCA TGTTGCAGGTCCTTGGAAAG GCCATTGTTTGAATAGC AGCTGTATCTGTAGAAG ing their respective generitypes, P. squamaria and S. coriacea, are included in the analysis. Materials and Methods Abbreviations.—GoM 5 Gulf of Mexico, MB 5 Bayesian analysis (including posterior probability values), ML 5 Maximum Likelihood (including bootstrap support), MP 5 Maximum Parsimony (including bootstrap support), NE 5 northeastern, NW 5 northwestern, SE 5 southeastern, SW 5 southwestern. DNA extraction, amplification, and sequencing for rbcL and the middle third of 26S LSU rDNA.—Silica gel-dried and alcohol liquid-preserved specimens, and extracted DNA samples are deposited at the University of Louisiana at Lafayette (LAF, http://sciweb.nybg.org/science2/ IndexHerbariorum.asp) and stored at 220uC. DNA samples were prepared using the DNAeasy Plant Minikit (Qiagen, Valencia, CA). Plastid encoded rbcL and LSU rDNA were selected to infer a phylogeny of red algae. Protocols for DNA extraction, gene amplification, and sequencing are as described by Gavio & Fredericq (2002) using the rbcL PCR primers F7-R577, F7-R753, F7-R851.1, F40-R753, F40-R851.1, F52R577, F52-R753, F52-R851.1, F577R851.1, F577-R1150, F645-R1150, F645R1434, F645-RrbcStart, F709-R1150, F709-R1434, F709-RrbcStart, F993-R1434, F993-RrbcStart; and sequencing primers F7, F40, F52, F577, F709, F753, F993, R376, R471, R753, R851.1, R1105, 39 39 39 39 39 39 R1434, and RrbcStart (Lin et al. 2001, Gavio & Fredericq 2002). Newly designed primers for the Peyssonneliaceae are listed in Table 1. PCR (X-28F) and sequencing primers (X, W, 28D, 28F), listed in Lin et al. (2001) and Fredericq et al. (2003), are for the middle third of the LSU rDNA gene as shown in Freshwater et al. (1999:fig. 1) between the X and 28F primers for LSU rDNA. Alignment.—The sequenced samples analyzed in this investigation are listed in Table 2. The rbcL and LSU rDNA sequence data were compiled with Sequencher 4.1 (Gene Codes Corp., Ann Arbor, Michigan, U.S.A.), then imported into PAUP* 4.0b10 (Swofford 2003) and MacClade v4.0 (Maddison & Maddison 2000) for alignment. The LSU rDNA sequence data was first aligned using ClustalX 1.8 (Thompson et al. 1997) before it was imported into PAUP* 4.0b for added manual alignment. In the LSU rDNA dataset, the unalignable regions were excluded from the analysis. Phylogenetic Analysis.—Phylogenetic analyses were conducted with the Maximum Parsimony (MP) algorithm as implemented in PAUP*, Maximum Likelihood (ML) algorithms as utilized in PHYML (Guindon & Gascuel 2003), and Bayesian inference as implemented in MrBayes 3.0 (MB) (Huelsenbeck & Ronquist 2001). The first 100 base pairs (bp) of the rbcL dataset were excluded as too much data was missing in this region of the alignment. The first dataset contains 85 rbcL sequences. In this data file seven samples Chondrus crispus Stackh. Ceramium brevizonatum var. caraibicum H. Petersen & Børgesen in Børgesen Champia compressa Harvey Centroceras clavulatum (C. Agardh) Mont. Caulacanthus ustulatus (Mertens ex Turner) Kütz. Caloglossa ogasawaraensis Okamura Caloglossa leprieurii (Mont.) G. Martens Calliblepharis ciliata (Hudson) Kütz. Callophyllis pinnata Setchell & Swezy Botryocladia shanskii E. Y. Dawson Batrachospermum gelatinosum (L.) De Candolle Bonnemaisonia asparagoides (Woodward) C. Agardh Bonnemaisonia hamifera Hariot Bostrychia radicans (Mont.) Mont. Acrochaetium secundatum (Lyngbye) Nägeli Agardhiella subulata (C. Agardh) Kraft & M. J. Wynne Ahnfeltia fastigiata (Endlicher) Makienko Ahnfeltia plicata (Hudson) Fries Ahnfeltia plicata (Hudson) Fries Antithamnionella spirographidis (Schiffner) E. M. Wollaston Apophlaea lyallii J. D. Hooker & Harvey Audouinella hermannii (Roth) Duby Audouinella violacea (Kütz.) Hamel Species Florida Middle Ground, Florida, U.S.A., 28u33.0649N, 89u16.4689W (#LAF-8-10-00-1-1) Ireland Punta La Cruz, Ancon, Lima, Peru (#LAF-8-30-03-1-1) Yucatan, Mexico Long Bay Point, Isla Colón, Caribbean Panama Pighuet, Brittany, France Angelmo mercado, Puerto Montt, Chile (# LAF-2-16-94-2-1, #DMK-255). Isla Mayagües, La Parguera, Puerto Rico (#JAW-3387, #DMK-50) Charlotte Harbor, Florida, U.S.A. (#JAW-4130, #DMK-28) Swakopmund, Namibia (#LAF-9-7-93-1-1) Sherwood & Sheath 2003 Harper & Saunders 2001 Morgan Creek, Orange Co., North Carolina, U.S.A. Vis et al. 1998 Norway, s.l. Harper & Saunders 2001 St. Louis Bay, Mississippi, U.S.A. Harper & Saunders 2002a Federal Basin, New Hanover Co., North Carolina, U.S.A. Harper & Saunders 2001 Harper & Saunders 2001 Broadhaven, Pembrokeshire, Wales, U.K. Burghsluis, The Netherlands Collection Locality rbcL: AF534411 LSU: AF419102 rbcL: U04033 LSU: AF419104 LSU: AF419105 rbcL: U04168 rbcL: AY591925 LSU: AF528044 rbcL: U04176 GenBank Accession Number rbcL: AF099687 LSU: EU349097 rbcL: DQ374331 rbcL:EU349107 rbcL: AF385653 rbcL: AY294397 LSU: EU349092 LSU: EU349106 B. Gavio & B. Wysor, 10 Aug 2000 rbcL: U02984 LSU: AF097883 rbcL: AY294358 C. F. D. Gurgel, 13 Feb 1998 LSU: AF259415 M. H. Hommersand, 7 Nov 1993 N. Arakaki, 30 Aug 2003 J. A. West, 19 Sep 2000 J. Cabioch, 22 Jun 1993 S. Fredericq & M. E. Ramı́rez, 24 Feb 1994 J. A. West, 1 May 1993 rbcL: AF029140 rbcL: AF212188 LSU: AF419112 C. F. D. Gurgel, 11 Feb 1998 rbcL: AF259497 LSU: AF259407 B. Wysor, 19 Oct 1999 rbcL: AY168662 J. Rueness, s.d. D. W. Freshwater, 29 Apr 1993 C. A. Maggs, 9 Feb 1993 M. H. Hommersand, 8 Aug 1997 D. W. Freshwater, Mar 1991 Collection Data Table 2.—List of species used in the rbcL and LSU rDNA analyses with collection information and GenBank accession numbers. 368 PROCEEDINGS OF THE BIOLOGICAL SOCIETY OF WASHINGTON Port MacDonnell, Australia Botany Beach, Vancouver I., British Columbia, Canada (#MJW-10276, #DMK-257) Pigeon Point, San Mateo Co., California, U.S.A. M. H. Hommersand, 21 Dec 1992 United Kingdom C. A. Maggs, 1996 Manomet Bluffs, Plymouth Co, Massachusetts, M. H. Hommersand, 23 Apr U.S.A. (#DMK-258) 1993 Bodega Head, Sonoma Co., California, U.S.A. M. H. Hommersand, 23 May 1992 Ketchikan, Alaska, U.S.A. S. C. Lindstrom, 2 Jul 2000 Penmarch, Brittany, France M. H. Hommersand, 21 Dec 1992 Pigeon Pt., San Mateo Co., California, U.S.A. M. H. Hommersand, 21 Jun (#LAF-6-21-92-1-1, #DMK-250) 1992 Freshwater & Bailey 1998 Freshwater & Bailey 1998 Santec, Brittany, France J. Cabioch, 6 Apr 1993 Botany Bay, Vancouver I., British Columbia, M. J. Wynne, 11 Jul 1995 Canada (#MJW-10268) Murroran, Hokkaido, Japan (#LAF-9-6-93-1-1) S. Fredericq, 6 Sep 1993 Seal Rock, Lincoln Co., Oregon, U.S.A. E. C. Henry, 24 May 1993 Italy, s.n. E. Cecere, 25 Jul 1994 Anse de Caro, Brittanny, France Coll. J. Cabioch, 3 Jul 2000 Le Gall & Saunders 2007 Dilsea californica (J. Agardh) Kuntze Gloiopeltis tenax (Turner) Decaisne Gloiosiphonia verticillaris Farlow Gracilaria bursa-pastoris (S. G. Gmel.) P. C. Silva Gracilaria bursa-pastoris (S. G. Gmel.) P. C. Silva Gracilaria salicornia (C. Agardh) E. Y. Dawson Gelidiella acerosa (Forsskål) Feldmann & G. Hamel Gelidium pusillum (Stackh.) Le Jolis Gigartina pistillata (S. G. Gmel.) Stackh. Gloiopeltis furcata (Postels & Ruprecht) J. Agardh Gastroclonium subarticulatum (Turner) Kütz. Fauchea laciniata J. Agardh Furcellaria lumbricalis (Hudson) Lamouroux Endocladia muricata (Postels & Ruprecht) J. Agardh Dudresnaya verticillata (Withering) Le Jolis Dumontia contorta (S. G. Gmel.) Ruprecht Dilsea californica (J. Agardh) Kuntze rbcL: U04037 rbcL: EU349207 LSU: EU349088 GenBank Accession Number rbcL: EU349110 rbcL: UO4196 LSU: EU349099 rbcL: AY049375 LSU: EF033615 LSU: AF039551 LSU: AF039542 rbcL: AY294375 rbcL: EU349109 LSU: EU349100 rbcL: AY294355 rbcL: AY294371 rbcL: EU349215 rbcL: AY294378 LSU: EU349094 rbcL: UO4193 rbcL: UO4192 S. Fredericq & M. E Ramı́rez, 9 Feb 1994 M. H. & F. Hommersand, 28 rbcL: AY294379 Aug 1995 M. J. Wynne, 17 Jan 1996 LSU: EU349093 LSU: AF419133 LSU: EF033603 rbcL: U26812 C. F. D. Gurgel, 12 Dec 1998 rbcL: AF488813 Dicranema revolutum (C. Agardh) J. Agardh Cryptonemia undulata Sonder Delisea hypneoides Harvey Delisea pulchra (Greville) Mont. Cryptonemia luxurians (C. Agardh) J. Agardh S. Fredericq & S. M. Lin, 26 Aug 1993 Collection Data UTEX culture collection #1553 epiphytic on Cladophora, Fong Chei Sa, Kenting Natl. Park, S. Taiwan, (# LAF-8-26-93-2-2, #DMK-246) Praia Rasa, Rio de Janeiro, Brazil (#LAF-12-12-98-1-1) Harper & Saunders 2001 Le Gall & Saunders 2007 King George I., Antarctic Peninsula Collection Locality Compsopogon caeruleus (Balbis ex C. Agardh) Mont. Contarinia okamurae Segawa Species Table 2.—Continued. VOLUME 122, NUMBER 3 369 Tarcoola Beach, Australia (#LAF-9-21-95-1-1) Harper & Saunders 2002b Harper & Saunders 2002b Sand Key, Florida Keys, Florida, U.S.A. Kallymenia cribrosa Harvey Kallymenia limminghii Mont. Kallymeniopsis oblongifructa (Setchell) G. I. Hansen Liagora valida Harvey Nizymenia australis Sonder Lomentaria hakodatensis Yendo Mastocarpus papillatus (C. Agardh) Kütz. Mychodea hamata Harvey Nemastoma canariense (Kütz.) Mont. Nesophila hoggardii W. A. Nelson & N. M. Adams Lomentaria catenata Harvey Palm Beach, KwaZulu-Natal, South Africa J. N. Norris, R. H. Sims, & S. Reed, 4 Nov 1989 Tokawa, Choshi, Japan (#LAF-9-2-93-1-2, S. Fredericq & M. Yoshizaki, #DMK-248) Sep 1993 Kermelehen (Plouezoch), Brittany, France J. Cabioch, 12 Jun 1994 Dichato, Concepcı́on, Chile (#LAF-3-30-93-1-1) M. E. Ramı́rez, 30 Mar 1993 Port MacDonnell, Australia, 14 Jul 1995 M. H. Hommersand Canary Islands R. Haroun, s.d. W. side of Matu Kapiti I., New Zealand W. Nelson, 20 Dec 1994 (#LAF-12-20-1994-1-1, #DMK-244) Warrnambool, Victoria, Australia M. H. Hommersand, 13 Jun 1995 rbcL: AY294380 LSU: EU349095 rbcL: AF212191 rbcL: AY294370 rbcL: EU349210 LSU: EU349089 rbcL: AF212192 2LSU: EU349101 LSU: AY171612 LSU: AY171613 rbcL: EU349112 rbcL: EU349216 rbcL: EU349111 rbcL: AF534407 rbcL: AY028817 rbcL: AF257368 Sherwood & Sheath 2003 Sherwood et al. 2002 Wemeldinge, Zeeland, The Netherlands F. & M. H. Hommersand, 7 Aug 1997 M. H. Hommersand, 23 Jul 1993 M. H. & F. Hommersand, 21 Sep 1995 rbcL: AF534409 Sherwood & Sheath 2003 rbcL: AF259494 rbcL: AF488820 rbcL: U04173 rbcL: AY294361 LSU: EU349103 rbcL: AY049415 rbcL: AY049434 GenBank Accession Number Hildenbrandia angolensis Welwitsch ex W. West & G. S. West Hildenbrandia crouanii J. Agardh Hildenbrandia rivularis (Liebmann) J. Agardh Hypoglossum hypoglossoides (Stackh.) F. S. Collins & Hervey Jania natalensis Harvey C. Acleto & R. Zuninga, 3 Mar 1994 S. Guimarães & M. Fujii, 15 Sep 2001 S. Fredericq, 6 Sep 1993 E. C. Henry, 24 May 1993 S. M. Guimarães & M. Fujii, 17 Sep 2001 M. H. Hommersand, 20 Jun 1993 C. J. Bird, 3 Jul 1999 Collection Data Penmarch, Brittany, France Marataizes, Espiritu Santo, Brazil (#LAF-9-15-01-1-1, #DMK-251) Muroran, Hokkaido, Japan Seal Rock, Lincoln Co., Oregon, U.S.A. Parati Beach, Anchieta, Espiritu Santu, Brazil Pomquet harbor, Antigonish Co., Nova Scotia, Canada Yacilla, Paita, Piura, Peru Collection Locality Heterosiphonia plumosa (Ellis) Batters Grateloupia turuturu Yamada Halosaccion glandiforme (S. G. Gmel.) Ruprecht Halymenia floridana J. Agardh Gracilariopsis lemaneiformis (Bory de St. Vincent) E. Y. Dawson, Acleto & Foldvik Grateloupia dichotoma J. Agardh Gracilaria tikvahiae McLachlan Species Table 2.—Continued. 370 PROCEEDINGS OF THE BIOLOGICAL SOCIETY OF WASHINGTON Collection Locality King George I., Antarctic Peninsula Penmarch, Brittany, France Taiwan Fort Fisher, New Hanover Co., North Carolina, U.S.A. Valentin & Zetsche 1989 Plocamium sp. Polyides rotundus (Hudson) Greville Polyopes polyideoides Okamura Porphyra carolinensis J. Coll & J. Cox Porphyridium aerugineum Geitler Mosteiros, São Miguel, Azores (#SMG-04-117) Spiddall, Co. Galway, Ireland The Kowie, Port Alfred, South Africa Platoma cyclocolpum (Mont.) F. Schmitz Plocamium cartilagineum (L.) P. S. Dixon Plocamium corallorhiza (Turner) Harvey Nizymenia conferta (Harvey) Chiovitti, G. W. Saunders Warrnambool, Victoria, Australia & Kraft (#LAF-7-13-95-1-1) Ochtodes secundiramea (Mont.) Howe Baie Olive, Guadeloupe, French West Indies (#LAF-3-10-94-1-1, #DMK-245) Palmaria palmata (L.) Kuntze Skerries, Co. Dublin, Northern Ireland Paralemanea annulata (Kütz.) M. L. Vis & Orange Co., North Carolina, U.S.A. R. G. Sheath Peyssonnelia bornetii Boudouresque & Denizot Portofino, Italy, 2–20 m (#LAF-7-28-01-1-2, #DMK-218) Peyssonnelia replicata Kütz. Trafalgar Beach, KwaZulu-Natal, South Africa (#LAF-2-6-01-2-2, #DMK-241) Peyssonnelia rubra (Greville) J. Agardh Sestri Levante, Italy, 3 m (#LAF-8-2-01-1-1, #DMK-166) Peyssonnelia squamaria (S. G. Gmel.) Decaisne São Miguel, Azores (#SMG-05-152, # DMK-164) Peyssonnelia squamaria (S. G. Gmel.) Decaisne Catalunya, Spain (#CAT-06-10, #DMK-230) Phacelocarpus sessilis J. Agardh Warrnambool, Victoria, Australia (# LAF-7-13-95-1-1) Phacelocarpus tortuosus Endlicher & Diesing Shark’s Bay, The Kowie, Port Alfred, Cape Prov., South Africa Phyllophora crispa (Hudson) P. S. Dixon Spidall, Co. Galway, Ireland Phyllophora pseudoceranoı̈des (S. G. Gmel.) Woods Hole, Massachusetts, U.S.A. (#SLF-57) Newroth & A. R. A. Taylor Platoma chrysymenioides Gavio, Hickerson Dredged offshore Louisiana, U.S.A., & Fredericq 28u03.4929N, 92u27.6659W (60 m depth) Species Table 2.—Continued. rbcL: EU349175 rbcL: EU349114 D. Gabriel, 10 Oct 2005 D. Gabriel, 16 Jul 2006 M. H. Hommersand, 13 Jul 1995 M. H. Hommersand, 19 Jun 1993 M. D. Guiry, 7 Mar 1993 M. H. Hommersand, 1995 S. Fredericq, B. Gavio, C. F. D. Gurgel, & J. Lopez-Bautista, 27 May 2000 D. Gabriel, 5 Jun 2004 M. D. Guiry, 28 Feb 1993 M. H. Hommersand, 19 Feb 1993 S. Fredericq, 5 Feb 1994 M. H. Hommersand, 20 Jun 1993 rbcL: EU349178 B. Gavio, 2 Aug 2001 rbcL: X17597 rbcL: AF385643 rbcL: U04041 rbcL: U26818 rbcL: UO4214 LSU: FJ655936 rbcL: U21701 rbcL: U26817 rbcL: AY294362 rbcL: U02990 LSU: EU349096 rbcL: AY294372 rbcL: EU349179 Tom Schilz, 6 Feb 2001 rbcL: EU349209 LSU: EU349086 rbcL: U04186 rbcL: U04038 rbcL: EU349113 GenBank Accession Number rbcL: EU349181 LSU: EU349076 rbcL: EU349182 B. Gavio, 28 Jul 2001 M. H. Hommersand, 13 Jul 1995 A. Renoux, 10 Mar 1994 Collection Data VOLUME 122, NUMBER 3 371 Collection Locality Magang Harbor, NE Taiwan (#LAF-8-11-93-3-20) Portieria hornemannii (Lyngbye) P. C. Silva South Africa Portieria japonica (Harvey) P. C. Silva Tokawa, Choshi, Chiba Pref. Japan (#LAF-5-22-93-1-1, #DMK-247) Portieria tripinnata (Hering) De Clerck Palm Beach, KwaZulu-Natal, South Africa (#LAF-2-5-01-3-1) Predaea goffiana Ballantine, Ruiz & Aponte Campeche Banks, Mexico, 22u07.439N, 91u22.859W, 40 m (#LAF-6-17-05-4-1) Predaea laciniosa Kraft Hawaii, U.S.A. (#SLF-937) Pseudolitophyllum muricatum (Foslie) Steneck & R. T. Botanical Beach, Vancouver, British Columbia, Paine Canada Pterocladia lucida (Brown ex Turner) J. Agardh Owhiro Bay, South Wellington, New Zealand Pterocladiella capillacea (S. G. Gmel.) Bornet Torre a Mare, Bari, Italy Ptilophora leliaertii Tronchin & De Clerck Freshwater & Bailey 1998 Renouxia antillana Fredericq & J. N. Norris Jamaica Rhodogorgon carriebowensis J. N. Norris & Bucher St. Ann’s Bay, Jamaica Rhodopeltis borealis Yamada Hwa Pin Yen, Hsiao Liuchiu I., Taiwan Rhodymenia pseudopalmata (J. V. Lamouroux) Port Aransas jetty, Texas, U.S.A. P. C. Silva (#LAF-5-17-98-1-1, #DMK-249) Sarcodia ceylanica Harvey ex Kütz. Wan Li Dung, Kenting Natl. Park, S. Taiwan (#LAF-8-25-93-1-4) Sarcodia montagneana (Hooker f. & Harvey) J. Agardh Taipa, New Zealand Schizymenia apoda (J. Agardh) J. Agardh São Miguel, Azores (#SMG-05-259) Schizymenia dubyi (Chauvin ex Duby) J. Agardh Piguet, Brittany, France Solieria chordalis (C. Agardh) J. Agardh Rade de Brest, Brittany, France (#Deslandes-3-1-95) Solieria filiformis (Kütz.) P. W. Gabrielson Isla Culebra, Balboa, Pacific Panama (#LAF-4-4-99-1-1) Sonderopelta capensis (Mont.) comb. nov. herein Salmon Banks, KwaZulu-Natal, South Africa, 30 m (#LAF-2-6-01-11, #DMK-215) Sonderopelta coriacea Womersley & Sinkora Warrnambool, Australia (#LAF-7-13-95-1-1, K220) Sphaerococcus coronopifolius Stackh. Finavarra, Co. Clare, Ireland Spyridia clavata Kütz. Vero Beach, Indian River Co., Florida, U.S.A. (#LAF-9-1-04-1-1, #TC-2070) Titanophora incrustans (J. Agardh) Børgesen offshore Louisiana, U.S.A., 28u06.4709N, 90u55.3599W, 58 m Portieria hornemannii (Lyngbye) P. C. Silva Species Table 2.—Continued. rbcL: AF212185 GenBank Accession Number rbcL: EU349187 LSU: EU349081 rbcL: EU349190 LSU: EU349082 rbcL: AY294376 rbcL: EU349108 S. Fredericq & O. De Clerck, 6 Feb 2001 M. H. Hommersand, 13 Jul 1995 M. D. Guiry, 7 Feb 1993 Tae Oh Cho, C. F. D. Gurgel, & J. N. Norris, 1 Sep 2004 S. Fredericq & J. LopezBautista, 30 Jun 2001 rbcL: AY294365 rbcL: AY294356 B. Wysor, 4 Apr 1999 rbcL: U01048 rbcL: U01888 LSU: AF039547 C. Pueschel, s.d. rbcL: U04181 C. Pueschel, s.d. rbcL: U04183 S. Fredericq, 23 Aug 1993 rbcL: U26824 C. F. D. Gurgel, 17 May 1998 rbcL: AY168656 LSU: EU349102 S. Fredericq & S. M. Lin, 25 rbcL: U26819 Aug 1993 W. Nelson, 2 Jul 1993 rbcL: AY294374 D. Gabriel, 21 Sep 2005 LSU: EU349104 J. Cabioch, s.d. rbcL: AY294389 E. Deslandes, 3 Jan 1995 LSU: EU349098 LSU: EU349105 rbcL: AY294373 P. Vroom, 21 Jul 2003 P. Gabrielson, 8 Jun 1994 W. Nelson, s.d. E. Cecere, s.d. rbcL: EU349115 S. Fredericq, 17 Jun 2005 rbcL: EU349206 rbcL: U26825 LSU: EU349087 D. W. Freshwater, 5 Feb 2001 rbcL: EU349205 S. Fredericq & S. M. Lin, 11 Aug 1993 M. H. Hommersand M. Yoshizaki, 22 May 1993 Collection Data 372 PROCEEDINGS OF THE BIOLOGICAL SOCIETY OF WASHINGTON VOLUME 122, NUMBER 3 belong to the Peyssonneliaceae sensu stricto, i.e., Peyssonnelia and Sonderopelta, and an additional 77 samples are representatives of the other major red algal orders: Acrochaetiales, Ahnfeltiales, Bangiales, Batrachospermales, Bonnemaisoniales, Ceramiales, Compsopogonales, Corallinales, Cryptonemiales, Gelidiales, Gracilariales, Hildenbrandiales, Palmariales, Plocamiales, Porphyridiales, Rhodymeniales, Nemaliales, Nemastomatales, Rhodogorgonales, and Gigartinales. The Gigartinales sensu stricto is defined herein to include just the Gigartinaceae and Phyllophoraceae; and, the Gigartinales sensu lato includes the following groups: Dumontiaceae complex (including the Dumontiaceae, Kallymeniaceae, Polyidaceae, Rhizophyllidaceae), Solieriaceae complex (including the Caulacanthaceae, Cystocloniaceae, Dicranemataceae, Furcellariaceae, Mychodeaceae, Solieriaceae), and the Sphaerococcaceae complex (including the Endocladiaceae, Nizymeniaceae, Phacelocarpaceae, Sphaerococcaceae). Porphyridium aerugineum Geitler, representing the Porphyridiales, was used as the outgroup based on phylogenetic hypotheses derived from earlier global analyses of the Rhodophyta (e.g., Freshwater et al. 1994, Saunders & Hommersand 2004, Yoon et al. 2006). The second dataset contains 40 LSU rDNA sequences, including four sequences of Peyssonneliaceae sensu stricto and 36 sequences representing red algae belonging to the Acrochaetiales, Ahnfeltiales, Bonnemaisoniales, Ceramiales, Compsopogonales, Cryptonemiales, Gelidiales, Gigartinales [including Gigartinales sensu stricto, and the Dumontiaceae-complex, and Solieriaceae-complex], Gracilariales, Rhodymeniales, and Nemastomatales. Two of the Acrochaetiales, Acrochaetium secundatum (Lyngbye) Nägeli and Audouinella hermannii (Roth) Duby, were used as the outgroup. Parsimony-derived trees for each of the two data sets were inferred from a 373 heuristic search, excluding uninformative characters, consisting of 1000 random sequence additions holding 25 trees at each step, and the tree-bisection-reconnection (TBR) swapping algorithm. Support for nodes in the MP were assessed by calculating bootstrap proportion (BP) values (Felsenstein 1985) as implemented in PAUP* by generating 1000 bootstrap data sets, from resampled data, with 1000 random sequence additions. Optimal models of sequence evolution to fit the data alignment estimated by hierarchical likelihood ratio tests were performed by Modeltest v.3.6 (Posada & Crandall 1998). The model of sequence evolution chosen for data files was the GTR + I + G (General Time Reversible model with variable base frequencies, symmetrical substitution matrix). A ML phylogram was generated for each of the two data sets, using the substitution model, gamma distribution, and proportion of invariable sites determined by the model. For each data file, the ML tree and 1000 bootstrap trees were inferred by PhyML 3.0, using the Nearest Neighbor Interchange (NNI) branch swapping method. The optimal model of sequence evolution obtained for each data set was used to set up the Markov Chain Monte Carlo (MCMC) search for the Bayesian analyses. Four chains of the (MCMC) were run, sampling one tree every 100 generations for 2,000,000 generations starting with a random tree for each of the two data files. The analyses phylogenic inferences were based on the trees sampled after the ‘‘burn in’’ point. A 50% majority rule concensus, as implemented by PAUP*, was computed from those saved trees. This frequency corresponds to the posterior probability of the clades. Morphological studies.—Voucher specimens (Table 2) for morphological studies and phylogenetic analyses were liquidpreserved in 5% buffered Formalin/seawater, and/or pressed and air-dried on 374 PROCEEDINGS OF THE BIOLOGICAL SOCIETY OF WASHINGTON herbarium sheets, and deposited in the herbaria of the University of Louisiana at Lafayette (LAF) and the Algal Collection of the US National Herbarium (US); herbaria abbreviations follow Holmgren et al. (1990); taxon author names follow Brummitt & Powell (1992). Specimens that were sectioned for observation by a light microscope were stained with a 1% aqueous aniline blue acidified with 0.1% diluted HCl (Tsuda & Abbott 1985). Species identifications were based on original descriptions and critical comparisons of the literature (e.g., Taylor 1960, Denizot 1968, Boudouresque & Denizot 1975, Abbott & Hollenberg 1976, Schneider & Reading 1987) and, where possible, type specimens and topotype material were studied using the type method (Silva 1952, Silva et al. 1987). ducing specialized calcified cells (cystoliths) within the thallus (Fig. 1C). Reproduction.—Gametophytic thalli are monoecious or dioecious, with gametangia in nemathecia intermixed with paraphyses. Spermatangial branches erect, bearing abundant spermatangia (Fig. 1K). Carpogonial branches (Fig. 1J) 3–6 celled; auxiliary cells intercalary in 3–6 celled auxiliary cell branches. Gonimoblasts (Fig. 1L) formed from site of fusion of connecting filament segment to diploidized auxiliary cell. Tetrasporangia in nemathecia (Fig. 1H), cruciate (Fig. 1I), usually terminal on filaments intermixed with paraphyses. Habitat.—Growing predominately on rocks, shells, coralline crusts, corals, coral rubble, and other hard substrata; intertidal, and/or shallow to deep subtidal, to depths of 288 m. Results Sonderopelta Womersley & Sinkora, 1981:85 (Fig. 3) Sonderopelta coriacea Womersley & Sinkora, 1981:85 (Generitype) Comparative morphological studies of the generitypes of Peyssonnelia and Sonderopelta Peyssonnelia Decaisne, 1841:168 (Figs. 1, 2) Peyssonnelia squamaria (S. G. Gmelin) Decaisne, 1841:168 (Generitype). Basionym: Fucus squamarius S. G. Gmelin, 1768:171, pl. XX: figs. 1A, B. Thallus.—Prostrate (Fig. 1A, B, M), crustose, 70–500 mm thick, entire thallus tightly adherent to loosely attached to substratum by unicellular or multicellular rhizoids (Fig. 1O) to basally attached to substratum with most of thallus free floating. Thallus generally of two distinct layers: a unistratose hypothallus, and a multistratose perithallic layer (Fig. 1C); presence of subhypothallic layer in certain species (Fig. 1G, N). Dorsal and ventral surfaces of the thallus formed by cortical cells of the perithallus (Fig. 1E) and hypothallus (Fig. 1F), respectively. Species either lack, or contain hypobasal calcification (Fig. 1D), with some pro- Thallus.—Prostrate, crustose (Fig. 3A), cartilaginous, 0.5–1.5 mm thick (Fig. 3B), loosely attached to substratum, lacking or with regionalized calcification. Thallus with a stipe-like, dense interwoven mass of multicellular rhizoids (Fig. 3H–J) beneath the thallus, proximally becoming wider and fan-like (Fig. 3E, F) in appearance. Thallus multiaxial, internally composed of several cell rows that form the dorsal (Fig. 3C) and ventral (Fig. 3D) surfaces. Dorsal surface cells isodiametric (Fig. 3D, G), all other cells elongate (Fig. 3E, F). Reproduction.—Reproductive thalli not observed in this study. Habitat.—Growing on rocks; shallow subtidal at depths of 1.0–25 m. Molecular phylogenetic analysis of Peyssonneliaceae and its placement within the Florideophyceae Using, respectively, Porphyridiales and Acrochaetiales as outgroups, rbcL and VOLUME 122, NUMBER 3 nuclear LSU rDNA phylogenies reveal strongly defined clades of Peyssonneliaceae (Figs. 4–7). The Maximum Parsimony results (Fig. 4) are broadly congruent with the Bayesian and Maximum Likelihood results (Fig. 5); the MB posterior probabililty values have been added to the ML tree (Fig. 5). In general, each major clade at ordinal rank is well supported based on bootstrap replicates or posterior probability values, but many interordinal or family-complex relationships are unresolved. The Peyssonneliaceae species cluster into two clades (Figs. 4–7), the Peyssonnelia and Sonderopelta clades, well supported by both datasets and all analyses. In a global analysis of red algae, the MP analysis of rbcL (Fig. 4) strongly supports (MP 5 85) the monophyly of the Peyssonneliaceae, as does the ML (ML 5 99) (Fig. 5) and Bayesian analyses (MB 5 100) (Fig. 5). The MP and ML analyses (Figs. 4, 5) do not provide support for a clear sister relationship between the Peyssonneliaceae and other red algal groups; however, the family forms a well-supported grade with the Kallymeniaceae, Rhizophyllidaceae, and Dumontiaceae with MB (MB 5 100) but not with the Polyidaceae (Fig. 5), which strongly clusters with the Sphaerococcaceae under Bayesian inference (MB 5 93). In the MP (Fig. 4) and ML (Fig. 5) analyses, the sister relationship of the Polyidaceae is unsupported. The LSU rDNA (Figs. 6, 7) datasets strongly support the monophyly of the Peyssonneliaceae with full support in the MP (Fig. 6), and ML and MB analyses (Fig. 7). In MP, the sister relationship to the Peyssonneliaceae remains unresolved (Fig. 6), and the family clusters weakly in a clade comprising Kallymeniaceae, Dumontiaceae, Rhizophyllidaceae in the ML analysis (ML 5 70) and in the Bayesian analysis (MB 5 64) (Fig. 7). Bootstrap and posterior probability support for relationships forming the 375 backbone of the red algae are nonexistent. In all analyses, the Solieriaceae, Mychodeaceae, Cystocloniaceae, Caulacanthaceae, Dicranemataceae, and Furcellariaceae cluster together in a clade with either no (MP , 50) (Fig. 4), weak (ML 5 77) (Fig. 5) or full support (MB 5 100). There is no support for a sister relationship of the Gigartinaceae and Phyllophoraceae to other groups of red algae in the MP (Fig. 4), ML, and MB (Fig. 5) trees. A complex of families comprising the Sphaerococcaceae, Nizymeniaceae, Phacelocarpaceae, Gloiosiphoniaceae, and Endocladiaceae form a group, without support in the MP (Fig. 4) and ML (Fig. 5) analyses. There is weak (ML 5 75) support in the ML analysis and full support in the Bayesian analysis (Fig. 5) for this cluster of families, excluding the Sphaerococcaceae. The Cryptonemiales and Rhodymeniales form a sister relationship, without support, in the MP (Fig. 4) and ML (Fig. 5) rbcL trees but with full support in the MB analysis (Fig. 5). The position of the Nemastomatales to the Cryptonemiales and Rhodymeniales is equivocal; it is nested in a supergroup encompassing the Cryptonemiales, Rhodymeniales, Gracilariales, Gelidiales, and Ceramiales in MB with strong support (MB 5 99) but with no support in ML (Fig. 5). The topological position of the Nemastomatales, Ceramiales and remaining red algal orders in the rbcL MP and LSU rDNA (MP) (Fig. 6), and ML and MB trees (Fig. 7) are either not resolved or remain equivocal. Discussion Morphological conclusions.—Members of the Peyssonneliaceae share a crustose habit and nemathecial reproductive structures with some members of the Gigartinales; however, the development of carpogonial branches and auxiliary cell 376 PROCEEDINGS OF THE BIOLOGICAL SOCIETY OF WASHINGTON Fig. 1. Morphology of Peyssonnelia. A, Dorsal habit of thallus in P. squamaria; scale bar 5 1.0 cm. B, Dorsal habit of thallus in P. replicata; scale bar 5 1.0 cm. C, Thallus RVS (radial vertical section), illustrating a stone cell (cystolith), within perithallic filaments, and perithallial and hypothallial regions of thallus in P. rubra. D, Thallus RVS, showing rhizoids and demonstrating presence of hypobasal calcification in P. rubra. E, Dorsal view of thallus surface in P. bornetii. F, Ventral view of thallus surface in P. bornetii. G, Thallus RVS, illustrating perithallial, hypothallial, and subhypothallial regions in P. squamaria. H, VOLUME 122, NUMBER 3 branches differs markedly among groups. In the Polyidaceae, Rhizophyllidaceae, and in Rhodopeltis, these branches originate from a surface cell, in contrast to their lateral origin from an intercalary cortical cell in the Peyssonneliaceae. In all Rhizophyllidaceae and in Rhodopeltis, the carpogonial and auxiliary cell branches stop growth at the 3–(4) -celled stage beyond the outline of the original cortex. In contrast, in the Polyidaceae, carpogonial branches form only after the sterile filaments of the nemathecium reach a stage of 10–12 cells in length, then specific, shorter filaments develop carpogonia (Rao 1956). Typically, nuclei in both the basal cells of the carpogonial branch in the Rhizophyllidaceae, Polyidaceae and in Rhodopeltis become enlarged before fertilization, as do the cells flanking the auxiliary cell. In addition, these cells increase in size prior to fertilization (Wiseman 1977:figs. 1–11; Hommersand & Fredericq 1990:figs. 74, 75; Nelson & Adams 1993:fig. 9). In contrast to the Polyidaceae and Rhizophyllidaceae, carpogonial branches of the Peyssonneliaceae originate laterally on an intercalary cell of a nemathecial filament only after the nemathecium is fully developed; thus, they are formed secondarily (see Schneider & Reading 1987). The basal cells of the unfertilized carpogonial branches do not increase considerably in size (e.g., Guimarães & Fujii 1999:fig. 18) in contrast to those of the auxiliary branch (e.g., Hommersand & Fredericq 1990:fig. 77). 377 Kylin (1956) placed the Rhizophyllidaceae, Polyidaceae, and Peyssonneliaceae in the order Cryptonemiales, noting that the entire nemathecial structure in these families consists of accessory filaments, thus by definition the auxiliary cell branches are accessory as well. Papenfuss (1966), however, characterized the auxiliary cell branch in the Polyidaceae, which at that time included Rhodopeltis, as vegetative or non-accesssory, and Wiseman (1975) likewise interpreted the auxiliary cell branches of the Rhizophyllidaceae as homologous in position to those of a vegetative branch and hence nonaccessory in origin. Both of these families were subquently transferred to the Gigartinales by the latter authors. Nemathecial pustules are deceptively similar structures that arose more than once in red algae. Molecular data confirm the non-homology between nemathecia in the Peyssonneliaceae, and those of the Rhizophyllidaceae and the Polyidaceae. The Polyidaceae (Rao 1956), Rhizophyllidaceae (Wiseman 1977), and the genus Rhodopeltis (Nozawa 1970; Itono & Yoshizaki 1992a, b) share a common reproductive strategy in which the fertilized carpogonium first fuses with an intercalary cell of the carpogonial branch before forming a fusion cell product that may subsequently send out multiple connecting filaments that contact auxiliary cells in separate accessory filaments. Ochtodes J. Agardh (Rhizophyllidaceae) has been reported as both a procarpic and non-procarpic genus (Wiseman 1977), but r Tetrasporophyte thallus RVS, showing a nemathecium in P. squamaria. I, Multicellular paraphyses and cruciately divided tetraspores of nemathecium in P. squamaria. J, Gametophytic thallus RVS, illustrating three-celled carpogonial branch in P. dubyi; scale bar 5 5.0 mm. K, Gametophytic thallus RVS, showing spermatangial branch in P. dubyi; scale bar 5 5.0 mm. L, Gametophyte thallus RVS, demonstrating carpospores in P. dubyi; scale bar 5 5.0 mm. M, Ventral habit of thallus of P. squamaria; scale bar 5 1.0 cm. N, Thallus RVS, illustrating presence of rhizoids in P. coriacea. O, Branched multicellular rhizoids in P. bornetii. [Figs. A, G–I, M from Gabriel SMG-05-242 (AZU); Fig. B from Schilz LAF-2-6-01-2-2 (LAF); Figs. C, D from Gavio LAF-8-2-01-1-1 (LAF); Figs. E, F, O from Gavio LAF-7-28-01-1-2 (LAF); Figs. J–L from Maggs s.n.; Fig. N from Gavio IT03-12 (LAF)]. 378 PROCEEDINGS OF THE BIOLOGICAL SOCIETY OF WASHINGTON Fig. 2. Morphology of Sonderopelta capensis. A, Dorsal habit of thallus; scale bar 5 0.5 cm. B, Thallus RVS, demonstrating its thickness. C, Dorsal view of thallus surface. D, Ventral view of thallus surface. E, F, Thallus RVS, showing perithallial and hypothallial regions. G, Thallus RVS, demonstrating a layer of short-celled erect filaments at upper surface of thallus. H, Thallus RVS, illustrating cystoliths of perithallus in aggregations. I, Ventral habit of thallus, dense aggregation of rhizoids showing tomentose condition throughout surface; scale bar 5 0.8 cm. J, K, Thallus RVS, demonstrating hypobasal calcification and dense aggregation of rhizoids. [Figs. A, I from Fredericq & De Clerck LAF-2-6-01-11 (LAF); Figs. B, E, F, K from Fredericq & De Clerck LAF-2-6-01-5 (LAF); Figs. C, D, G, H, J from Fredericq & De Clerck LAF-2-6-01-l-18 (LAF)]. VOLUME 122, NUMBER 3 379 Fig. 3. Vegetative morphology of Sonderopelta coriacea. A, Dorsal habit of thallus; scale bar 5 2.0 cm. B, Thallus RVS, demonstrating its thickness. C, Dorsal view of thallus surface. D, Ventral view of thallus surface. E, F, Thallus RVS, showing multiaxial construction of thallus. G, Thallus RVS, illustrating layer of short-celled erect filaments at upper thallus surface. H, Ventral habit of thallus, showing localized regions of densely interwoven rhizoids (tomentose); scale bar 5 2.0 cm. I, Thallus RVS, containing dense aggregation of rhizoids. J, Branched multicellular rhizoids. [Fig. A from Clarke 214, isotype of Sonderopelta coriacea (US); Figs. B–J from Hommersand LAF-7-13-95-1-1 (LAF)]. 380 PROCEEDINGS OF THE BIOLOGICAL SOCIETY OF WASHINGTON Fig. 4. One of 48 most parsimonious trees based on rbcL sequences showing relationship of Peyssonneliaceae to other major red algal orders. Numbers at each node represent (maximum parsimony (MP) bootstrap values. VOLUME 122, NUMBER 3 381 Fig. 5. Maximum-likelihood tree of rbcL sequence data showing relationship of Peyssonneliaceae to other major red algal orders. Two tiers of numbers at each node; top numbers are maximum likelihood (ML) bootstrap values and bottom numbers are maximum Baysian (MB) posterior probabilities. we interpret Ochtodes as being similarly non-procarpic even though the connecting filament may be reduced in size to a short fusion process if the auxiliary cell is spatially close to the carpogonium. In contrast, the fertilized carpogonium in the Peyssonneliaceae does not fuse with an intercalary cell of the carpogonial branch prior to initiating a connecting filament. Sjöstedt (1926) placed the Polyidaceae close to the Dumontiaceae based on the shared character states of having separate carpogonial and auxiliary cell branches, and intercalary auxiliary cells but kept the families separate based on presence or absence of reproductive structures in nemathecia. Whereas the phylogenetic placement of the Polyidaceae is equivocal 382 PROCEEDINGS OF THE BIOLOGICAL SOCIETY OF WASHINGTON Fig. 6. One of six most parsimonious trees based on LSU rDNA sequences showing relationship of Peyssonneliaceae to other major red algal orders. Numbers at each node represent MP bootstrap values. Fig. 7. Maximum-likelihood tree of LSU sequence data showing relationship of Peyssonneliaceae to other major red algal orders. Two tiers of numbers at each node; top numbers are ML bootstrap values and bottom numbers are MB posterior probabilities. VOLUME 122, NUMBER 3 on the basis of the molecular data in the restricted dataset (Figs. 4, 5), a close systematic relationship between the Dumontiaceae and Rhizophyllidaceae, as proposed by Kylin (1930), is corroborated. On the other hand, links between these families and the Peyssonneliaceae and Corallinaceae (Norris 1957), and a proposed close relationship between the Dumontiaceae and Gloiosiphoniaceae (Kylin 1930, Abbott 1968), and between the Dumontiaceae and Halymeniaceae (Lewis & Kraft 1992) are refuted. A thorough study of the Dumontiaceae complex (i.e., Dumontiaceae, Kallymeniaceae, Polyidaceae, and Rhizophyllidaceae) will be done elsewhere; likewise a major study on the Sphaerococcaceae complex (i.e., Sphaerococcaceae, Nizymeniaceae, Phacelocarpaceae, Gloiosiphoniaceae, and Endocladiaceae) is forthcoming. Molecular conclusions.—Both the rbcL and LSU rDNA data suggest that the Peyssonneliaceae, represented by Peyssonnelia and Sonderopelta, forms a wellsupported monophyletic unit within the red algae. Phylogenies generated from the rbcL and LSU rDNA molecular datasets support the placement of the Peyssonneliaceae in its own order comparable to other recognized red algal orders. The molecular analyses presented herein also corroborate earlier molecular studies. First, the Gigartinales and Cryptonemiales sensu Kylin (1956) are polyphyletic, and some families (i.e., Rhizophyllidaceae, Dumontiaceae, and Kallymeniaceae) often placed in either of these orders form a clade. Second, the Plocamiaceae does not belong in the Gigartinales and the molecular data supports recognition of the order Plocamiales (Saunders & Kraft 1994, Fredericq et al. 1996a), in a clade with the Sarcodiaceae (Fredericq et al. 1996a, Saunders et al. 2004). And finally, a clade centered around the Halymeniaceae (5Cryptonemiaceae), the type of the Cryptonemiales (renamed Halymeniales 383 by Saunders & Kraft 1996), is allied to the Rhodymeniales (Gavio et al. 2005). Previous phylogenetic analyses revealed the following clades, constituting in part the Gigartinales sensu lato (e.g., Schneider & Wynne 2007): 1) an assemblage referred to as the Dumontiaceae complex (Fredericq et al. 1996b); 2) families comprising the Solieriaceae complex (Fredericq et al. 1999, N’Yeurt et al. 2006); 3) the Gigartinales sensu stricto with the Gigartinaceae (Hommersand et al. 1994), and the Phyllophoraceae (Fredericq et al. 2003); 4) families centered around the Sphaerococcaceae (Fredericq et al. 1996b); and 5) the Peyssonneliaceae (including the type species of Peyssonnelia). Many of these family complexes of the Gigartinales sensu lato represent red algal orders that are yet to be formally described (Fredericq et al. pers. comm..). The fact that some of these relationships are not recovered with strong support in the present rbcL and LSU rDNA analyses is indicative of the restricted taxon sampling of each of these monophyletic groups when subjected to a global analysis of the red algae. RbcL and LSU rDNA sequence analyses also suggest that two genera, Metapeyssonnelia and Polystrata, genera formerly placed in the Peyssonneliaceae, are in all likelihood members of the Dumontiaceae complex (unpublished data, awaiting type material for confirmation). A study of the Dumontiaceae complex will be published separately to better assess the placement of Metapeyssonnelia and Polystrata within the red algae. Additional taxonomic notes on Peyssonneliaceae.—The taxonomic history and placement of this family is complicated. Peyssonnelia Decaisne (1841:168, pl. V: figs 16, 17, as ‘Peyssonellia’) is the type of the Peyssonneliaceae Denizot. The generitype, Peyssonnelia squamaria (S. G. Gmelin) Decaisne, 1842a:360 (basionym: Fucus squamarius S. G. Gmelin, 1768:171, pl. XX: fig. 1a, b (vide Decaisne, 384 PROCEEDINGS OF THE BIOLOGICAL SOCIETY OF WASHINGTON 1842b:126), was originally described in the ‘‘family’’ Choristosporeae Descaisne. Since then, generic placement has been somewhat problematic. In the same year, another genus Squamaria Zanardini (1841:235), was described based on S. vulgaris Zanardini and placed in its own family Squamariaceae Zanardini (1841, as ‘‘order Squamarieae’’; see McNeill et al. 2006: Art. 18.3). Although Squamaria Zanardini is taxonomically the same as Peyssonnelia, since it is a later homonym of the higher plant Squamaria Ludwig (1757:120), it is an illegitimate name. Thus Peyssonnelia Decaisne (1841) is the valid name and correct spelling for the genus. Hauck (1885) considered Peyssonnelia to belong in its own family, the Squamariaceae Hauck, which is a homonym of Squamariaceae Zanardini (1841), and Squamariaceae J. Agardh (1851). However, the family name Squamariaceae, proposed by these three authors independently, is also illegitimate, since it was based on an illegitimate generic name, Squamaria Zanardini (1841). Nevertheless, Peyssonnelia was retained within the ‘‘Squamariaceae’’ for over 100 yr (e.g., Zanardini 1841, 1858; Agardh 1851, Kylin 1956), until Denizot (1968, as ‘‘Peyssonneliacées’’) recognized the illegitimacy of the name Squamariaceae and proposed Peyssonneliaceae as the replacement name for the family (see also Silva 1980). Taxonomic conclusions.—In addition to the suite of reproductive characters that circumscribe the Peyssonneliaceae, rbcL and LSU rDNA have proven to be adequate genes of choice to infer relationships among genera, families and orders of red algae. Comparative gene sequence analyses confirm that the Gigartinales and Cryptonemiales need to be re-characterized and subdivided into several orders (Freshwater et al. 1994, Saunders & Kraft 1994, 1996; Fredericq et al. 1996b, Saunders et al. 2004). The Peyssonneliaceae forms a monophyletic assemblage that cannot be maintained in the Gigartinales sensu lato, and thus constitutes a distinct order, proposed herein. Peyssonneliales Krayesky, Fredericq, & J. N. Norris, ord. nov. Diagnosis.—Crustacea, prostrata, plerumque epilithica taxa, infernae paginae omnino usque ad partialiter affixae substrato cum aut sine rhizoideis unicellulosis aut multicellulosis. Species acalcareae omnino, aut saepe partialiter calcareae calcificatione hypobasali inter rhizoidea, aut interdum calcareae omnino. Calcite si presens in forma mineralis aragoniti. Prostratum incrementum per radiatim marginales series aut per initia apicalia divisa transversim in basali strato postea dividentia verticaliter formantia singulares supernas aut infernas perithalli cellulas. Cellulae perithalli producentes filamenta simplicia aut ramosa erecta, simul formantes corticem laxum usque ad compactum superum inferumque aut superum solum (perithallus). Synapses continentes onturamenta sine stratis capitularibus. Chloroplasti numerosi discoidei. Gametophyti monoecii sed dioecii. Masculina nemathecia fasciculatis spermatangialibus filamentis formatis apicalibus aut intercalaribus. Fila carpogonialia fila auxiliaresque ambo 3–6 cellularum longa genita lateraliter in filamentis erectis in nematheciis, fila connectentia saepe conniventia ad plus quam unicam cellulam auxiliarem, formantes cellulas fusionales parvas usque ad extendentes ferentes gonimoblastos, pro parte maxima cellulis evolvantibus in curtas, simplices, aut ramosas catenas carposporangiorum. Gonimoblasti formati aliter filis connectentibus. Tetrasporophyti gametophytique isomorphi. Tetrasporangia terminalia lateraliaque in nematheciis superficialibus cruciatim divisa inter paraphyses graciles multicellularesque. Description.—Crustose, prostrate, usually epilithic, with the lower surfaces partially to completely attached to substratum, with or without unicellular or VOLUME 122, NUMBER 3 multicellular rhizoids. Thalli non-calcified throughout, or often partially calcified with hypobasal calcification between the attachment rhizoids, or sometimes calcified throughout. Calcium carbonate, if present, in the mineral form aragonite. Prostrate growth by radiating marginal rows of transversely dividing apical initials in the basal layer, that later divide vertically to form single upper or lower perithallial cells. First order perithallial cells give rise to simple or branched erect filaments, and these together form a loose to compact, upper and lower, or upper only, cortex (perithallus) (Denizot 1968). Ultrastructurally, pit plugs without cap layers. Chloroplasts numerous; discoid or ribbon-like in shape. Tetrasporophytes and gametophytes isomorphic. Gametophytes, where known, monoecious or dioecious. Male nemathecia with spermatangial filament development apical and intercalary; growth sympodial or apical. Carpogonial branches and auxiliary cell branches each 3–6 cells long, borne laterally on erect filaments in nemathecia; with connecting filaments often attaching to more than one auxiliary cell to form small to sprawling fusion cells bearing gonimoblasts, with most cells developing in short, simple, or branched chains of carposporangia. Gonimoblasts may also form directly from the connecting filament. Tetrasporangia cruciate; terminal or lateral in tetrasporic nemathecia; multicellular paraphyses present or absent. With one family, Peyssonneliaceae Denizot (1968), containing two genera, Peyssonnelia and Sonderopelta. Type.—Peyssonnelia squamaria (S. G. Gmelin) Descaine, 1841:168 [basionym: Fucus squamarius S. G. Gmelin, 1768:171, pl. XX: figs. 1A, B]. In addition, one species, Peyssonnelia capensis, is recognized to belong to another genus of the Peyssonneliaceae (Peyssonniales), and is here transferred to Sonderopelta. 385 Sonderopelta capensis (Montagne) Krayesky, comb. nov. Basionym: Peyssonnelia capensis Montagne, Ann. Sci. Nat. Bot., ser. 3, 7:177. 1847. Lectotype: #Drège 44, (PC). Type locality: Durban, South Africa (fide Papenfuss, 1952:175). Homotypic synonym: Pterigospermum capense (Montagne) Kuntze, Rev. Gen. Pl. 2:914. 1891. Heterotypic synonyms: Peyssonnelia major Kützing (as ‘Peys sonelia’) Flora 30:774. 1847. Pterigospermum majus (Kützing) Kuntze, Rev. Gen. Pl. 2:914. 1891. Peyssonnelia australis Sonder, Linnaea 25(6):685. 1853. Ethelia australis (Sonder) Weber-van Bosse, Monogr. Siboga-Exped. 59b:300. 1921 Sonderophycus australis (Sonder) Denizot, Alg. Florid. Encrout.: 260, 307. 1968. Peyssonnelia australis Areschoug, Nova Acta Regiae Soc. Sci. Upsal., ser. 3, 1:352. 1854. Ralfsia major Kützing, Tab. Phyc. 9:32. 1859. Peyssonnelia coccinea J. Agardh, Sp. alg., 3(1):385. 1876. Pterigospermum coccineum (J. Agardh) Kuntze, Rev. Gen. Pl. 2:914. 1891. Peyssonnelia gunniana J. Agardh, Sp. alg., 3(1):387. 1876. Description.—Thallus prostrate, thick, cartilaginous, crustose and lobed (Fig. 2A), with upper surface dark red, and lower surface pale-red; partly attached to the substratum by tomentosely arranged, multicellar rhizoids from ventral surface (Fig. 2B, E, F, I–K), most of ventral thallus unattached (free from substratum). Anatomically of two layers: a ventral hypothallus, and a dorsal perithallus (Fig. 2B, E, F, J). Basal layer of perithallus of ascending filaments at 386 PROCEEDINGS OF THE BIOLOGICAL SOCIETY OF WASHINGTON angles of 20–30u in the lower and middle perithallus, with the apical portions of filaments in the upper perithallus bending to a 90u angle (Fig. 2F, G). Perithallial cells, elongated in basal layer, and isodiametric in upper layer (Fig. 2C, D, G). Cystoliths present, forming globular aggregates of cone-shaped crystals in the perithallus (Fig. 2B, G, H, J). Tetrasporangia in nemathecia on dorsal surface; cruciate, usually terminal on filaments intermixed with paraphyses. Gametangial structures not observed. Remarks.—Although Sonderopelta capensis is in general agreement with the generitype S. coriacea, it lacks the multiaxial growth and nemathecial filaments among its tetrasporangia as found in S. coriacea. However, both the rbcL and LSU rDNA data suggest these two species are closely allied. Morphologically both are thick, fleshy lobed crusts, with multicellular rhizoids that become densely interwoven (tomentose), more so in S. capensis. The upper (dorsal) portion of mature thalli in S. capensis and S. coriacea reveal a layer of shortcelled, erect filaments bearing the more elongated cells of the curved filaments of the perithallus, a condition not observed in Peyssonnelia sensu stricto (Fig. 1). Specimens studied.—Isotype: Sonderopelta coriacea, #US Alg. Type Coll.13487 (distributed as ‘‘Marine Algae of Southern Australia no. 214 [5ADA52035]’’); Pondalowie Bay, Yorke Peninsula, South Australia, 2–3 m depth, S. M. Clarke, 14 Feb 1981. South Africa: KwaZulu-Natal: Salmon Banks, 30 m depth, 6 Feb 2001, S. Fredericq & O. De Clerck #LAF-2-6-01-5 (LAF), LAF2-6-01-11 (LAF), and LAF-2-6-01-l-18 (LAF); and, Mabibi: Sodwana Reef, 16 m depth, 13 Feb 2001, S. Fredericq & O. De Clerck #LAF-2-13-01-l-11 (LAF). Australia: Warrnambool, 13 Jul 1995, M. H. Hommersand #LAF-7-1395-1-1 (LAF). Acknowledgments We thank all collectors listed in Table 2, and the R/V Pelican (LUMCON) crew for their help in collecting subtidal, crustose algae. Our appreciation goes to numerous colleagues who have offered comments and discussions that have lead to improvement of our manuscript. This study was supported by NSF Systematic Biology: PEET (DEB-0328491), and Peyssonneliaceae (DEB-0919508); NSF Biodiversity Inventories: Gulf of Mexico (DEB-0315995, and Panama (DEB0743024); US-Panama Cooperative Research Program (OISE-0819205). This research represents Smithsonian Marine Station at Fort Pierce Contribution No. SMSFP-791, and Caribbean Coral Reef Ecosystem Program of the National Museum of Natural History Contribution No. CCRE-862. Literature Cited Abbott, I. A. 1968. Studies in some foliose red algae of the Pacific coast, III: Dumontiaceae, Weeksiaceae, Kallymeniaceae.—Journal of Phycology 4:180–198. ———, & G. J. Hollenberg. 1976. Marine Algae of California. Stanford University Press, Stanford, California, 827 pp. Agardh, J. G. 1851. Species genera et ordines algarum, seu descriptiones succinctae specierum, generum et ordinum, quibus algarum regnum constituitur. Volumen secundum: algas florideas complectens, part 2, fasc. 1. C. W. K. Gleerup, Lundae, 167 pp. ———. 1876. Species genera et ordines algarum, seu descriptiones succinctae specierum, generum et ordinum, quibus algarum regnum constituitur. Volumen tertium: de florideis curæ posteriores. Part 1. T. O. Weigel, Lipsiae, vii + 724 pp. Areschoug, J. E. 1854. Phyceae novae et minus cognitae in maribus extraeuropaeis collectae quas descriptionibus atque obscrvationibus adumbravit John Erh. Areschoug.—Nova Acta Regiae Societatis Scientiarum Upsaliensis, ser. 3 1:329–372. Ballantine, D. L., & N. E. Aponte. 2005. An annotated checklist of deep-reef benthic marine algae from Lee Stocking Island, Bahamas (western Atlantic), II: Rhodophyta.—Nova Hedwigia 80:147–171. VOLUME 122, NUMBER 3 ———, & H. Ruiz. 2005. Two Peyssonnelia species (Peyssonneliaceae, Rhodophyta) from Puerto Rico including Peyssonnelia flavescens sp. nov.—Phycologia 44:328–334. ———, & ———. 2006. Peyssonnelia imbricata sp. nov. (Peyssonneliaceae, Rhodophyta) from Puerto Rico, Caribbean Sea.—Botanica Marina 49:431–437. Boudouresque, C.-F., & M. Denizot. 1975. Révision du genre Peyssonnelia (Rhodophyta) en Méditerranée.—Bulletin Muséum d’Histoire Naturelle de Marseille 35:7–92. ———, E. Coppejans, & J. Marcot. 1976. Un nouveau genre de Peyssonneliaceae, Metapeyssonnelia (Rhodophyta).—Phycologia 15:283–288. Brummitt, R. K., & C. E. Powell, eds. 1992, Authors of Plant Names. Royal Botanic Gardens, Kew, 732 pp. Cabioch, J. 1974. Un fond de maerl de l’Archipel de Madère et son peuplement végétal.—Bulletin de la Société Phycologique de France 19:74–82. Crouan, P. L., & H. M. Crouan. 1859. Notice sur quelques espèces et genres nouveaux d’algues marines de la rade de Brest.—Annales des Sciences Naturelles, Botanique, sér. 4 12:288–292. Decaisne, J. 1841. Plantes de l’Arabie Heureuse, recueillies par M. P.-E. Botta et décrites par M. J. Decaisne.—Archives du Muséum d’Histoire Naturelle [Paris] 2:89–199, pls. V–VII. ———. 1842a. Essais sur une classification des algues et des polypiers calcifères de Lamouroux.—Annales des Sciences Naturelles, Botanique, sér. 2 17:297–380, pls. 14–17. ———. 1842b. Essais sur une classification des algues et des polypiers calcifères de Lamouroux. [2nd part.] Mémoire sur les Corallines ou Polypiers calcifères.—Annales des Sciences Naturelles, Botanique, sér. 2 18:96–128. Denizot, M. 1968. Les algues Floridées encroutantes (à l’exclusion des Corallinacées). Thesé, Laboratoire de Cryptogamie, Muséum national d’Histoire naturelle), Paris, 310 pp. Felsenstein, J. 1985. Confidence limits on phylogenies: an approach using the bootstrap.— Evolution 39:783–791. Foster, M. S., R. Riosmena-Rodrı́guez, D. L. Steller, & W. J. Woelkerling. 1997. Living rhodolith beds in the Gulf of California and their implications for paleoenvironmental interpretation. Pp. 127–139 in M. E. Johnson and J. Ledesma-Vázquez, eds., Pliocene Carbonates and Related Facies Flanking the Gulf of California, Baja California, Mexico. Special Paper 318—Geological Society of America, Boulder, Colorado. 387 Fredericq, S., R. J. Anderson, & J. Lopez-Bautista. 2003. Circumscription of some Phyllophoraceae (Gigartinales, Rhodophyta) from the Cape region, South Africa, based on molecular evidence. Pp. 263–274 in A. R. O. Chapman, R. J. Anderson, V. J. Vreeland and I. R. Davison, eds., Proceedings of the XVIIth International Seaweed Symposium, Cape Town, South Africa, 28 January–2 February 2001. Oxford University Press, Oxford. ———, D. W. Freshwater, & M. H. Hommersand. 1999. Observations on the phylogenetic systematics and biogeography of the Solieriaceae (Gigartinales, Rhodophyta) inferred from rbcL sequences and morphological evidence.—Hydrobiologia 398/399:25–38. ———, M. H. Hommersand, & D. W. Freshwater. 1996a. The molecular systematics of some agar- and carrageenan-containing marine red algae based on rbcL sequence analysis.— Hydrobiologia 326/327:125–135. ———, J. N. Norris, E. A. Zimmer, D. W. Freshwater, & M. H. Hommersand. 1996b. Proposal of the Dumontiales ord. nov. and reinstatement of the Sphaerococcales Sjoestedt emend. based on family complexes previously placed in the marine red algal order Gigartinales.—Journal of Phycology 32(s3):16. Freshwater, D. W., & J. C. Bailey. 1998. A multigene phylogeny of the Gelidiales including nuclear large-subunit rRNA sequence data.—Journal of Applied Phycology 10:229–236. ———, S. Fredericq, & J. C. Bailey. 1999. Characteristics and utility of nuclear-encoded large-subunit ribosomal gene sequences in phylogenetic studies of red algae.—Phycological Research 47:33–38. ———, ———, B. S. Butler, M. H. Hommersand, & M. W. Chase. 1994. A gene phylogeny of the red algae (Rhodophyta) based on plastid rbcL.—Proceedings of the National Academy of Sciences of the United States of America 91:7281–7285. Gavio, B., & S. Fredericq. 2002. Grateloupia turuturu (Halymeniaceae, Rhodophyta) is the correct name of the non-native species in the Atlantic known as Grateloupia doryphora.—European Journal of Phycology 37:349–359. ———, E. L. Hickerson, & S. Fredericq. 2005. Platoma chrysymenioides sp. nov. (Schizymeniaceae), and Sebdenia integra sp. nov. (Sebdeniaceae), two new red algal species from the northwestern Gulf of Mexico, with a phylogenetic assessment of the Cryptonemiales complex (Rhodophyta).—Dedicated 388 PROCEEDINGS OF THE BIOLOGICAL SOCIETY OF WASHINGTON Issue, Flower Garden Banks National Marine Sanctuary, Gulf of Mexico Science 25(1):38–57. Gmelin, S. G. 1768. Historia Fvcorvm. Ex typographia Academiae scientiarum, Petropoli [St. Petersburg], [xii] + 239 + 6 pp., 35 pls. [1A, IB, IIA, IIB, III–XXXIII]. Guimarães, S. M. P. B., & M. T. Fujii. 1999. Morphological studies of five species of Peyssonnelia (Gigartinales, Rhodophyta) from southeastern Brazil.—Phycologia 38: 167–183. Guindon, S., & O. Gascuel. 2003. A simple, fast, and accurate algorithm to estimate large phylogenies by maximum likelihood.—Systematic Biology 52:696–704. Harper, J. T., & G. W. Saunders. 2001. Molecular systematics of the Florideophyceae (Rhodophyta) using nuclear large and small subunit rDNA sequence data.—Journal of Phycology 37:1073–1082. ———, & ———. 2002a. A re-classification of the Acrochaetiales based on molecular and morphological data, and establishment of the Colaconematales ord. nov. (Florideophyceae, Rhodophyta).—European Journal of Phycology 37:463–476. ———, & ———. 2002b. Using molecular data to resolve the taxonomic limits of the genera Callophyllis, Euthora and Pugetia (Kallymeniaceae, Rhodophyta).—Phycological Research 50:275–281. Hauck, F. 1885. Die Meeresalgen Deutschlands und Oesterreichs. In Dr. L. Rabenhorst’s Kryptogamen-Flora von Deutschland, Oesterreich und der Schweiz. Vol. 2. Zweite Auflage. Verlag von Eduard Kummer, Leipzig, xxiv + 575 [576] pp. Heydrich, F. 1905. Polystrata, eine Squamariacee aus den Tropen.—Berichte der Deutschen Botanischen Gesellschaft 23:30–36. Hollenberg, G. J. 1970. Phycological notes. IV. Including new marine algae and new records for California.—Phycologia 9:61–72. Holmgren, P. K., N. H. Holmgren, & L. C. Barnett. 1990. Index Herbariorum. Pt. 1: The Herbaria of the World. 8th Edition. New York Botanical Garden, New York, x + 693 pp. Hommersand, M. H., & S. Fredericq. 1990. Sexual reproduction and cystocarp development. Pp. 305–345 in K. M. Cole and R. G. Sheath, eds., Biology of the Red Algae. Cambridge University Press, New York, 517 pp. ———, ———, & D. W. Freshwater. 1994. Phylogenetic systematics and biogeography of the Gigartinaceae (Gigartinales, Rhodophyta) based on sequence analysis of rbcL.— Botanica Marina 37:193–203. Huelsenbeck, J. P., & F. Ronquist. 2001. MRBAYES: Bayesian inference of phylogeny.—Bioinformatics 17:754–755. Itono, H., & M. Yoshizaki. 1992a. Female reproductive morphology and taxonomy of Rhodopeltis Harvey (Polyidaceae, Rhodophyta). I. R. australis Harvey and R. borealis Yamada.—Reports of the Faculty of Science, Kagoshima University (Earth Science & Biology) 25:125–135. ———, & ———. 1992b. Female reproductive morphology and taxonomy of Rhodopeltis Harvey (Polyidaceae, Rhodophyta). II. R. gracilis Yamada et Tanaka, R. liagoroides Yamada and R. setchelliae Yamada.—Reports of the Faculty of Science, Kagoshima University (Earth Science & Biology) 25:137–147. James, N. P., J. L. Wray, & R. N. Ginsburg. 1988. Calcification of encrusting aragonitic algae (Peyssonneliaceae); implications for the origin of late Paleozoic reefs and cements.—Journal of Sedimentary Research 58:291–303. Johnson, J. H. 1964. Paleocene calcareous red algae from northern Iraq.—Micropaleontology 10:207–216. Kato, A., & M. Masuda. 2002. A morphological study of Peyssonnelia meridionalis (Gigartinales, Rhodophyta), with discussion of spermatangial types within the genus.—Phycologia 41:191–198. ———, & ———. 2003. A new crustose red alga Peyssonnelia rumoiana (Rhodophyta, Gigartinales) from Japan.—Phycological Research 51:21–28. Kraft, G. T., & P. Robins. 1985. Is the order Cryptonemiales (Rhodophyta) defensible?— Phycologia 24:67–77. Kuntze, [C. E.] O. 1891. Revisio generum plantarum vascularium omnium atque cellularium multarum secundum leges nomenclaturae internationales cum enumeratione plantarum exoticarum in itinere mundi collectarum. Part 2. Pp. 377–1011. Arthur Felix, Leipzig [etc.]. Kützing, F. T. 1847. Diagnosen einiger neuen ausländischen Algenspecies, welche sich in der Sammlung des Herrn Kammerdirectors Klenze in Laubach befinden.—Flora 30:773–776. ———. 1859. Tabulae phycologicae; oder, Abbildungen der Tange. Vol. 9. Kosten des Verfassers (In Commission bei Ludwig Klincksieck), Nordhausen, viii + 42 pp., 100 pls. Kylin, H. 1930. Über die Entwicklungsgeschichte der Florideen.—Lunds Universitets Årsskrift, Ny Följd, Andra Afdelningen 26(6):1–103 + [1]. VOLUME 122, NUMBER 3 ———. 1932. Die Florideenordnung Gigartinales.— Lunds Universitets Årsskrift, Ny Följd, Andra Afdelningen 28(8):1–88, 22 figs., 28 pls. ———. 1956. Die Gattungen der Rhodophyceen. C. W. K. Gleerup, Lund, xv + 673 pp. Le Gall, L., & G. W. Saunders. 2007. A nuclear phylogeny of the Florideophyceae (Rhodophyta) inferred from combined EF2, small subunit and large subunit ribosomal DNA: establishing the new red algal subclass Corallinophycidae.—Molecular Phylogenetics and Evolution 43:1118–1130. Leliaert, F., & E. Coppejans. 2004. Crystalline cell inclusions: a new diagnostic character in the Cladophorophyceae (Chlorophyta).—Phycologia 43:189–203. Lewis, J. A., & G. T. Kraft. 1992. Zymurgia, a new genus in the Halymeniaceae (Gigartinales, Rhodophyta) from southeastern Australia.— Phycologia 31:285–299. Lin, S.-M., S. Fredericq, & M. H. Hommersand. 2001. Systematics of the Delesseriaceae (Ceramiales, Rhodophyta) based on large subunit rDNA and rbcL sequences, including the Phycodryoideae, subfam. nov.—Journal of Phycology 37:881–899. Littler, M. M., D. S. Littler, S. M. Blair, & J. N. Norris. 1985. Deepest known plant life discovered on an uncharted seamount.— Science 227:57–59. ———, ———, ———, & ———. 1986. Deepwater plant communities from an uncharted seamount off San Salvador Island, Bahamas: distribution, abundance, and primary productivity.—Deep-Sea Research 33:881–892. Ludwig, C. G. 1757. Institutiones historico-physicae regni vegetabilis in usum auditorium adornatae a D. Christano Gottlieb Ludwig … vegetabilis praelectionibus academicis accomodatae. Editio altera aucta et emendate. [2nd Edition] Joh. Fridericum Gleditschium, Leipzig, [xiv] + 264 + [10] pp. Maddison, D. R., & W. P. Maddison. 2000. MacClade 4: Analysis of phylogeny and character evolution. Sinauer Associates, Sunderland, Massachusetts, Maggs, C. A. 1990. Distribution and evolution of non-coralline crustose red algae in the North Atlantic. Pp. 241–264 in D. J. Garbary and G. R. South, eds., Evolutionary Biogeography of the Marine Algae of the North Atlantic (NATO ASI Series, Sub-Series G, Ecological Sciences). Springer-Verlag, Berlin, 429 pp. McNeill, J., et al. (2006). International Code of Botanical Nomenclature (Vienna Code). Regnum Vegetabile, vol. 146. A. R. G. Gantner Verlag, Ruggell, Lichenstein, xviii + 568 pp. 389 Moe, R. L. 1985. Gainia and Gainiaceae, a new genus and family of crustose marine Rhodophyceae from Antarctica.—Phycologia 24:419–428. Montagne, C. 1847. Enumeratio fungorum quos a cl. Drège in Africa meridionali collectos et in herbario Miqueliano servatos descriptionibus nonnullis illustravit.—Annales des Sciences Naturelles, Botanique, sér. 3, 7:166–181. Nelson, W. A., & N. M. Adams. 1993. Nesophila hoggardii gen. et sp. nov. (Rhizophyllidaceae, Rhodophyta) from offshore islands of northern New Zealand.—Museum of New Zealand Records 1:1–7. [Tuhinga: Records of the Museum of New Zealand Te Papa Tongarewa 5:1–8 (1996)] Norris, R. E. 1957. Morphological studies on the Kallymeniaceae.—University of California Publications in Botany, Berkeley 28:251–334. Nozawa, Y. 1970. Systematic anatomy of the red algal genus Rhodopeltis.—Pacific Science 24:99–133. N’Yeurt, A. D. R., C. E. Payri, P. W. Gabrielson, & S. Fredericq. 2006. Pinnatiphycus menouana gen. et sp. nov. (Rhodophyta: Dicranemataceae) from New Caledonia and Fiji (South Pacific): vegetative and reproductive morphology and molecular phylogeny.—Phycologia 45:422–431. Papenfuss, G. F. 1966. A review of the present system of classification of the Florideophycidae.—Phycologia 5:247–255. Posada, D., & K. A. Crandall. 1998. MODELTEST: testing the model of DNA substitution.—Bioinformatics 14:817–818. Pueschel, C. M. 1989. An expanded survey of the ultrastructure of red algal pit plugs.—Journal of Phycology 25:625–636. Rao, C. S. P. 1956. The life-history and reproduction of Polyides caprinus (Gunn.) Papenf.— Annals of Botany 20:211–230. Rasser, M. W., & B. Riegl. 2002. Holocene coral reef rubble and its binding agents.—Coral Reefs 21:57–72. Saunders, G. W., & M. H. Hommersand. 2004. Assessing red algal supraordinal diversity and taxonomy in the context of contemporary systematic data.—American Journal of Botany 91:1494–1507. ———, & G. T. Kraft. 1994. Small-subunit rRNA gene sequences from representatives of selected families of the Gigartinales and Rhodymeniales (Rhodophyta). 1. Evidence for the Plocamiales ord.nov.—Canadian Journal of Botany 72:1250–1263. ———, & ———. 1996. Small-subunit rRNA gene sequences from representatives of selected families of the Gigartinales and Rhodyme- 390 PROCEEDINGS OF THE BIOLOGICAL SOCIETY OF WASHINGTON niales (Rhodophyta). 2. Recognition of the Halymeniales ord.nov.—Canadian Journal of Botany 74:694–707. ———, A. Chiovitti, & G. T. Kraft. 2004. Smallsubunit rDNA sequences from representatives of selected families of the Gigartinales and Rhodymneniales (Rhodophyta). 3. Delineating the Gigartinales sensu stricto.— Canadian Journal of Botany 82:43–74. Schmitz, F. 1883. Untersuchungen über die Befruchtung der Florideen.—Sitzungsberichten der Königlichen Akademie der Wissenschaften zu Berlin 1883(1):215–258, pl. 5. ———. 1892. (6. Klasse Rhodophyceae.) 2. Unterklasse Florideae. Pp. 16–23 in A. Engler, ed., Syllabus der Vorlesungen über specielle und medicinisch-pharmaceutische Botanik. Grosse Ausgabe [Edition 1]. Gebr. Borntraeger, Berlin, 184 pp. Schneider, C. W., & R. P. Reading. 1987. A revision of the genus Peyssonnelia (Rhodophyta, Cryptonemiales) from North Carolina, including P. atlantica new species.—Bulletin of Marine Science 40:175–192. ———, & M. J. Wynne. 2007. A synoptic review of the classification of red algal genera a half century after Kylin’s ‘‘Die Gattungen der Rhodophyceen.’’—Botanica Marina 50:197–249. Searles, R. B. 1968. Morphological studies of red algae of the order Gigartinales.—University of California Publications in Botany 43:1–86. Sherwood, A. R., & R. G. Sheath. 2003. Systematics of the Hildenbrandiales (Rhodophyta): gene sequence and morphometric analyses of global collections.—Journal of Phycology 39:409–422. ———, T. B. Shea, & R. G. Sheath. 2002. European freshwater Hildenbrandia (Hildenbrandiales, Rhodophyta) have not been derived through multiple invasions from marine habitats.— Phycologia 41:87–95. Silva, P. C. 1952. A review of nomenclatural conservation in the algae from the point of view of the type method.—University of California Publications in Botany 25:241–323. ———. 1980. Names of classes and families of living algae, with special reference to their use in the Index Nominum Genericorum (Plantarum). Regnum vegetabile, vol. 103. Bohn, Scheltema, & Holkema, Utrecht, [iii] + 156 pp. ———, & H. W. Johansen. 1986. A reappraisal of the order Corallinales (Rhodophyceae).— European Journal of Phycology 21(3):245– 254. ———, E. G. Meñez, & R. L. Moe. 1987. Catalog of the benthic marine algae of the Philippines. Smithsonian Contributions to the Marine Sciences; no. 27. Smithsonian Institution Press, Washington, D.C, iv + 179 pp. Sjöstedt, L. G. 1926. Floridean studies.—Lunds Universitets Årsskrift, ny följd 2 22(4):1–94. Sonder, O. G. 1853. Plantae Muellerianae. Algae.— Linnaea 25:657–703. Stockar, R. 2001. Polystrata alba (Pfender) Denizot and Peyssonnelia antiqua Johnson: two peyssonneliacean algae (Rhodophyta) from the Paleocene of the Tabiago Formation (Montorfano Member Section type-section, Como, Northern Italy).—Geologia Insubrica 6:15– 22. Swofford, D. L. 2003. PAUP*: Phylogenetic Analysis Using Parsimony (*and other methods). Version 4.0. Sinauer Associates, Sunderland, Massachusetts. Taylor, W. R. 1960. Marine Algae of the Eastern Tropical and Subtropical Coasts of the Americas. University of Michigan Press, Ann Arbor, Michigan, xi + 870 pp. Thompson, J. D., T. J. Gibson, F. Plewniak, F. Jeanmougin, & D. G. Higgins. 1997. The CLUSTAL_X windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tools.—Nucleic Acids Research 25(24):4876–4882. Tsuda, R. T., & I. A. Abbott. 1985. Collection, handling, preservation, and logistics. Pp. 67–86 in M. M. Littler and D. S. Littler, eds., Handbook of Phycological Methods: Volume 4: Ecological Field Methods: Macroalgae. Cambridge University Press, New York. Valentin, K., & K. Zetsche. 1989. The genes of both subunits of ribulose-1,5-bisphosphate carboxylase constitute an operon on the plastome of a red alga.—Current Genetics 16(3):203–209. Vis, M. L., G. W. Saunders, R. G. Sheath, K. Dunse, & T. J. Entwisle. 1998. Phylogeny of the Batrachospermales (Rhodophyta) inferred from rbcL and 18S ribosomal RNA gene sequences.—Journal of Phycology 34(2):341–350. Weber-van Bosse, A. 1921. Liste des algues du Siboga. II. Rhodophyceae. Premère partie. Protofloridae, Nemalionales, Cryptonemiales.—SibogaExpeditie Monographie 59b:187–310, figs. 53– 109, pls. VI–VII. Leiden. Wiseman, D. R. 1975. On the status of the red algal family, the Rhizophyllidaceae (Gigartinales).—Taxon 24:489–490. ———. 1977. Observations on the reproductive morphology of the red algal genus Ochtodes J. Agardh (Rhizophyllidaceae, Gigartinales).— Phycologia 16:1–8. Womersley, H. B. S. 1994. The Marine Benthic Flora of Southern Australia. Rhodophyta. Part IIIA. Bangiophyceae and Florideophyceae (Acrochaetiales to Gigartinales). Flora VOLUME 122, NUMBER 3 of Australia Supplementary Series Number 1. Australian Biological Resources Study, Canberra, 508 pp. ———, & D. Sinkora. 1981. Sonderophycus and the type specimen of Peyssonnelia australis (Cryptonemiales, Rhodophyta).—Transactions of the Royal Society of South Australia 105(2):85–87. Yoneshigue, Y. 1985. Taxonomie et Ecologie des Algues Marines dans la Région de Cabo Frio (Rio de Janeiro, Brésil). Thèse de Docteur d’Etat-Sciences, Faculté des Sciences de Luminy, à l’Université d’Aix-Marseille II, 466 pp. Yoon, H. S., K. M. Müller, R. G. Sheath, F. D. Ott, & D. Bhattacharya. 2006. Defining the major lineages of red algae (Rhodophyta).—Journal of Phycology 42(2):482–492. Zanardini, G. [A. M.]. 1841. Synopsis Algarum in mari Adriatico hucusque collectarum, cui 391 accedunt Monographia Siphonearum nec non generales de Algarum vita et structura disquisitiones cum tabulis auctoris manu ad vivum depictis.—Memorie della Reale Accademia delle Scienze di Torino, Ser. 2, Tome 4:105–255, pls. I–VIII. [also reprinted: with same title & date, 153 pp., pls. 1–8. Taurini [Torino]: Regio Typographeo.] ———. 1858. Plantarum in mari Rubro hucusque collectarum enumeriato (juvante A. Figari).—Memorie del Reale Istituto Veneto di Scienze, Lettere ed Arti 7(2):209–309, pls. III–XIV. Zhang, D., & J. Zhou. 1981. Ramicrusta, a new genus of Peyssonneliaceae (Cryptonemiales, Rhodophyta).—Oceanologia et Limnologia Sinica 12(6):538–544. Associate Editor: Carol Hotton.

RELATED PAPERS

RELATED TOPICS

Log In

A new order of red algae based on the Peyssonneliaceae, with an evaluation of the ordinal classification of the Florideophyceae (Rhodophyta)

A new order of red algae based on the Peyssonneliaceae, with an evaluation of the ordinal classification of the Florideophyceae (Rhodophyta)

Related Papers

RELATED PAPERS

RELATED TOPICS