PROCEEDINGS OF THE BIOLOGICAL SOCIETY OF WASHINGTON
122(3):364–391. 2009.
A new order of red algae based on the Peyssonneliaceae, with an
evaluation of the ordinal classification of the
Florideophyceae (Rhodophyta)
David M. Krayesky, James N. Norris*, Paul W. Gabrielson, Daniela Gabriel, and
Suzanne Fredericq
(DMK, DG, SF) Department of Biology, University of Louisiana at Lafayette, Lafayette,
Louisiana 70504-2451, U.S.A.;
(DMK) present address: Department of Biology, Slippery Rock University of Pennsylvania,
Slippery Rock, Pennsylvania 16057, U.S.A., e-mail:
david.krayesky@sru.edu, danielagabriel@gmail.com, & slf9209@louisiana.edu;
(JNN) Department of Botany, MRC 166, National Museum of Natural History, Smithsonian
Institution, Washington, D.C. 20013-7012, U.S.A., e-mail: norrisj@si.edu;
(PWG) Herbarium, University of North Carolina at Chapel Hill, Chapel Hill, North Carolina
27599-3280, U.S.A., e-mail: drseaweed@hotmail.com
Abstract.—The Peyssonneliaceae Denizot comprises a worldwide group
of non-calcified or calcified, crust-forming red algae found in diverse,
intertidal to deep subtidal marine habitats. Eight genera have been
recognized in the family, with Peyssonnelia Decaisne having the largest
number of species. Both comparative morphology and rbcL and nuclear
LSU rDNA sequence data support the monophyly of the family and show
that it cannot be maintained in the order Gigartinales Schmitz. A new order,
Peyssonneliales, is herein proposed to accommodate the Peysonneliaceae,
with only two of the genera (i.e., Peyssonnelia and Sonderopelta), and its
relationship to the other red algal orders is discussed. We also propose the
transfer of one species, Peyssonnelia capensis Montagne to Sonderopelta
Womersley & Sinkora.
The red algal family Peyssonneliaceae
Denizot (1968) represents a diverse group
of non-calcified and calcified crustose
algae. Although some of the more heavily
calcified species are superficially similar in
habit to some of the crustose (nonarticulated) coralline algae (Corallinaceae, Corallinales), they differ markedly
in the organization of their reproductive
structures. In the Peyssonneliaceae, the
reproductive structures are confined to
nemathecia, which are external pustules
that develop from simultaneous transverse division of surface cells forming a
dome-shaped aggregation of assimilatory
* Corresponding author.
filaments (Denizot 1968). In contrast, no
nemathecia are formed in members of the
Corallinaceae, as an analogous structure,
a sorus, contains the reproductive structures (Silva & Johansen 1986). Further
differences between these groups include
the ultrastructure of their pit-plugs
(Pueschel 1989), and the mineral form of
calcium carbonate as aragonite (Leliaert
& Coppejans 2004:200) in the Peyssonneliaceae versus calcite in the Corallinaceae
(Silva & Johansen 1986).
Members of the Peyssonneliaceae occur
in arctic, temperate, subtropical, and
tropical waters worldwide. With nearly
100 non-calcified and calcified species, the
family represents a model group for
VOLUME 122, NUMBER 3
global biogeographic studies of red algae.
Some of the more calcified members of
the Peyssonneliaceae, along with crustose
corallines, form algal nodules or rhodoliths (maërl) and act as substrata for the
establishment of reef communities (Cabioch 1974, Littler et al. 1985, 1986;
Foster et al. 1997, Rasser & Riegl 2002).
Species of Peyssonnelia Decaisne (1841)
occur from the intertidal to shallow
subtidal and into deep-water habitats at
depths of 200–288 m in the Bahamas,
making them among the deepest occurring photosynthetic organisms (Littler et
al. 1985, 1986). The Peyssonneliaceae is
one of the few red algal families for which
fossils are known; fossil evidence suggests
that species of Peyssonnelia and Polystrata Heydrich (1905) were present 65 to
100 million years ago (Johnson 1964,
James et al. 1988, Stockar 2001).
The Peyssonneliaceae has a predominantly prostrate, crustose growth form
that is generally arranged into two, or
sometimes three, layers: a perithallus
(upper cell layer more or less perpendicular to the basal hypothallus), and a
hypothallus (lowermost cell layer, usually
more or less parallel to the substratum);
some taxa may also have a third layer, the
mesothallus (middle layer). Denizot’s
(1968) monograph of the Peyssonneliaceae included the genera Peyssonnelia and
Cruoriella P. et H. Crouan (1859) and
suggested that Polystrata may also be in
this family. More recent studies have
treated Cruoriella as a synonym of
Peyssonnelia (e.g., Yoneshigue 1985,
Maggs 1990, Womersley 1994, Guimarães
& Fujii 1999).
Taxonomic Placement of Peyssonnelia
and the Peyssonneliaceae
Currently eight genera are reported as
belonging to the Peyssonneliaceae (Schneider & Wynne 2007), Peyssonnelia Decaisne; Polystrata Heydrich; Chevaliericrusta Denizot (1968); Riquetophycus De-
365
nizot (1968); Pulvinia Hollenberg (1970);
Metapeyssonnelia Boudouresque, Coppejans et Marcot (1976); Ramicrusta D. R.
Zhang et J. H. Zhou (1981); and Sonderopelta Womersley et Sinkora (1981). Of
these genera, the most species-rich is
Peyssonnelia, with more than 70 species
worldwide (e.g., Kato & Masuda 2002,
2003; Ballantine & Aponte 2005; Ballantine & Ruı́z 2005, 2006).
The Peyssonneliaceae (as the ‘‘Squamariaceae Zanardini’’) was originally
placed in the Cryptonemiales F. Schmitz (1892). Schmitz (1883, 1892) defined
red algal orders based on the comparative developmental morphology of reproductive structures and characterized
the Cryptonemiales as a non-procarpic
group. In the non-procarpic condition,
auxiliary cells are scattered throughout
the thallus and spatially removed from
the egg cells (carpogonia). Long connecting filaments extend from the fertilized
carpogonia and contact the auxiliary
cells, resulting in the formation of sporebearing gonimoblasts of the carpospoprophyte generation. Subsequently, Kylin
(1956) refined Schmitz’s classification
system and distinguished six orders of
Florideophycideae (Rhodophtya). Kylin
defined the condition where the auxiliary
cell forms a tight unit with the carpogonium, and the gonimoblast develops from
the auxiliary cell upon its direct fusion
with the fertilized carpogonium, as the
procarpic condition (Silva & Johansen
1986). Kylin (1956, as ‘‘Squamariaceae’’)
maintained Peyssonnelia in the family,
within the Cryptonemiales F. Schmitz
(see also discussions of Kraft & Robins
1985, Silva & Johansen 1986, Hommersand & Fredericq 1990).
Two of the six orders recognized by
Kylin (1956), the Gigartinales F. Schmitz
(1892) and Cryptonemiales F. Schmitz
(1892), were initially based on the origin
and location of their generative auxiliary
cells. Kylin (1932) placed algae in which
auxiliary cells correspond to cells in
366
PROCEEDINGS OF THE BIOLOGICAL SOCIETY OF WASHINGTON
ordinary vegetative filaments in the Gigartinales, whereas algae possessing auxiliary cells that are borne in filaments formed
in addition to those of normal vegetative
growth (‘‘accessory’’ filaments) in the
Cryptonemiales. Phycologists have since
questioned the validity of the auxiliary
cell location as a taxonomic character
alone to separate these two orders (e.g.,
Searles 1968). Kraft & Robins (1985)
concluded that Kylin’s (1932, 1956) concept of the term ‘‘accessory’’ was artificial
and proposed merging the two into a
single large order, the Gigartinales, providing an opportunity to reevaluate taxonomic concepts in the Gigartinales sensu
lato. Since the treatment of Kylin (1956)
and the proposal of Kraft & Robins
(1985), the concept of the GigartinalesCryptonemiales complex has changed, for
example several families (i.e., Ahnfeltiaceae, Corallinaceae, Gracilariaceae, and
Plocamiaceae), previously included in
either order, have since been the basis
for newly established orders (i.e., Ahnfeltiales, Corallinales, Gracilariales, and
Plocamiales).
Within the Gigartinales sensu lato (see
below) there exist four morphologically diverse, non-procarpic families that
are distinguished from other families in
the order by their development of reproductive structures (gametangia or tetrasporangia) in nemathecia on separate
individuals. These ‘‘nemathecial’’ families
are: Polyidaceae Kylin (1956, as ‘‘Polyideaceae’’), Rhizophyllidaceae Schmitz
(1892), Peyssonneliaceae Denizot, and
Gainiaceae Moe (1985). The first three
families were placed in the Cryptonemiales by Kylin (1956) on the basis of the
accessory position of the auxiliary cell
branch. Subsequently, Papenfuss (1966)
and Wiseman (1975), respectively, transferred the Polyidaceae and Rhizophyllidaceae from the Cryptonemiales to the
Gigartinales on grounds of the nonaccessory position of the auxiliary cell
branch. The Peyssonneliaceae is currently
placed in the Gigartinales (e.g., Saunders
et al. 2004), whereas previous studies
recognized the Peyssonneliaceae as belonging in the Cryptonemiales (e.g., Moe
1985, Schneider & Reading 1987). [A
distinction is made herein between the
Gigartinales sensu stricto (comprising
only the Gigartinaceae and Phyllophoraceae), and the Gigartinales sensu lato
(including the remaining families in the
order, sensu Saunders et al. 2004).]
The few molecular systematic investigations of the phylogenetic relationships
of the Peyssonneliaceae to other members
of the Class Florideophyceae included
only a few taxa of Peyssonneliaceae, and
none sampled included the generitype or
specimens from the species’ type localities. Studies of Fredericq et al. (1996b),
Harper & Saunders (2001), and Saunders
et al. (2004) using, respectively, chloroplast-encoded rbcL, nuclear SSU rDNA
and LSU rDNA sequences, implied that
the Peyssonneliaceae is a monophyletic
group that lacks support for any close
relationships among or within the other
orders of the Florideophyceae and suggested the family may best be placed in its
own order. Phylogenetic analyses of rbcL
data sets spanning a wide array of red
algae at the family and ordinal rank (e.g.,
Fredericq et al. 1996b) revealed that the
Peyssonneliaceae does not to belong in
the complex comprising the Polyidaceae
or Rhizophyllidaceae; instead the latter
two families formed a well-supported
clade with members of the Dumontiaceae
and Kallymeniaceae (both non-nemathecial families traditionally placed in the
Cryptonemiales).
The purpose of this investigation is to
test the taxonomic status of the Peyssonneliaceae, based on the type of the family
and to elucidate the phylogenetic position
of the family within the red algae
(Rhodophyta), using chloroplast encoded
rbcL, large subunit (LSU) rDNA, and
comparative morphological data. Species
of Peyssonnelia and Sonderopelta, includ-
VOLUME 122, NUMBER 3
367
Table 1.—Newly designed oligonucleotide rbcL PCR and sequencing primers used in this study.
Primer
F40
F52
F709
R471
R851.1
R1434
Sequence
59
59
59
59
59
59
CGTTATGAGTCAGGTGTAATTCC
TCAGGTGTAATTCCATATGC
GGTGAAGTTAAAGGTCA
TGTTGCAGGTCCTTGGAAAG
GCCATTGTTTGAATAGC
AGCTGTATCTGTAGAAG
ing their respective generitypes, P. squamaria and S. coriacea, are included in the
analysis.
Materials and Methods
Abbreviations.—GoM 5 Gulf of Mexico, MB 5 Bayesian analysis (including
posterior probability values), ML 5
Maximum Likelihood (including bootstrap support), MP 5 Maximum Parsimony (including bootstrap support), NE
5 northeastern, NW 5 northwestern, SE
5 southeastern, SW 5 southwestern.
DNA extraction, amplification, and
sequencing for rbcL and the middle third
of 26S LSU rDNA.—Silica gel-dried and
alcohol liquid-preserved specimens, and
extracted DNA samples are deposited
at the University of Louisiana at Lafayette (LAF, http://sciweb.nybg.org/science2/
IndexHerbariorum.asp) and stored at
220uC. DNA samples were prepared
using the DNAeasy Plant Minikit (Qiagen, Valencia, CA). Plastid encoded
rbcL and LSU rDNA were selected to
infer a phylogeny of red algae. Protocols
for DNA extraction, gene amplification, and sequencing are as described
by Gavio & Fredericq (2002) using the
rbcL PCR primers F7-R577, F7-R753,
F7-R851.1, F40-R753, F40-R851.1, F52R577, F52-R753, F52-R851.1, F577R851.1, F577-R1150, F645-R1150, F645R1434, F645-RrbcStart, F709-R1150,
F709-R1434, F709-RrbcStart, F993-R1434,
F993-RrbcStart; and sequencing primers
F7, F40, F52, F577, F709, F753, F993,
R376, R471, R753, R851.1, R1105,
39
39
39
39
39
39
R1434, and RrbcStart (Lin et al. 2001,
Gavio & Fredericq 2002). Newly designed
primers for the Peyssonneliaceae are listed
in Table 1. PCR (X-28F) and sequencing
primers (X, W, 28D, 28F), listed in Lin et
al. (2001) and Fredericq et al. (2003), are
for the middle third of the LSU rDNA
gene as shown in Freshwater et al.
(1999:fig. 1) between the X and 28F
primers for LSU rDNA.
Alignment.—The sequenced samples
analyzed in this investigation are listed
in Table 2. The rbcL and LSU rDNA
sequence data were compiled with Sequencher 4.1 (Gene Codes Corp., Ann
Arbor, Michigan, U.S.A.), then imported
into PAUP* 4.0b10 (Swofford 2003) and
MacClade v4.0 (Maddison & Maddison
2000) for alignment. The LSU rDNA
sequence data was first aligned using
ClustalX 1.8 (Thompson et al. 1997)
before it was imported into PAUP* 4.0b
for added manual alignment. In the LSU
rDNA dataset, the unalignable regions
were excluded from the analysis.
Phylogenetic Analysis.—Phylogenetic
analyses were conducted with the Maximum Parsimony (MP) algorithm as implemented in PAUP*, Maximum Likelihood (ML) algorithms as utilized in
PHYML (Guindon & Gascuel 2003),
and Bayesian inference as implemented
in MrBayes 3.0 (MB) (Huelsenbeck &
Ronquist 2001). The first 100 base pairs
(bp) of the rbcL dataset were excluded as
too much data was missing in this region
of the alignment.
The first dataset contains 85 rbcL
sequences. In this data file seven samples
Chondrus crispus Stackh.
Ceramium brevizonatum var. caraibicum H.
Petersen & Børgesen in Børgesen
Champia compressa Harvey
Centroceras clavulatum (C. Agardh) Mont.
Caulacanthus ustulatus (Mertens ex Turner) Kütz.
Caloglossa ogasawaraensis Okamura
Caloglossa leprieurii (Mont.) G. Martens
Calliblepharis ciliata (Hudson) Kütz.
Callophyllis pinnata Setchell & Swezy
Botryocladia shanskii E. Y. Dawson
Batrachospermum gelatinosum (L.) De Candolle
Bonnemaisonia asparagoides (Woodward) C. Agardh
Bonnemaisonia hamifera Hariot
Bostrychia radicans (Mont.) Mont.
Acrochaetium secundatum (Lyngbye) Nägeli
Agardhiella subulata (C. Agardh) Kraft &
M. J. Wynne
Ahnfeltia fastigiata (Endlicher) Makienko
Ahnfeltia plicata (Hudson) Fries
Ahnfeltia plicata (Hudson) Fries
Antithamnionella spirographidis (Schiffner) E. M.
Wollaston
Apophlaea lyallii J. D. Hooker & Harvey
Audouinella hermannii (Roth) Duby
Audouinella violacea (Kütz.) Hamel
Species
Florida Middle Ground, Florida, U.S.A.,
28u33.0649N, 89u16.4689W
(#LAF-8-10-00-1-1)
Ireland
Punta La Cruz, Ancon, Lima, Peru
(#LAF-8-30-03-1-1)
Yucatan, Mexico
Long Bay Point, Isla Colón, Caribbean
Panama
Pighuet, Brittany, France
Angelmo mercado, Puerto Montt, Chile (#
LAF-2-16-94-2-1, #DMK-255).
Isla Mayagües, La Parguera, Puerto Rico
(#JAW-3387, #DMK-50)
Charlotte Harbor, Florida, U.S.A.
(#JAW-4130, #DMK-28)
Swakopmund, Namibia (#LAF-9-7-93-1-1)
Sherwood & Sheath 2003
Harper & Saunders 2001
Morgan Creek, Orange Co., North Carolina,
U.S.A.
Vis et al. 1998
Norway, s.l.
Harper & Saunders 2001
St. Louis Bay, Mississippi, U.S.A.
Harper & Saunders 2002a
Federal Basin, New Hanover Co., North
Carolina, U.S.A.
Harper & Saunders 2001
Harper & Saunders 2001
Broadhaven, Pembrokeshire, Wales, U.K.
Burghsluis, The Netherlands
Collection Locality
rbcL: AF534411
LSU: AF419102
rbcL: U04033
LSU: AF419104
LSU: AF419105
rbcL: U04168
rbcL: AY591925
LSU: AF528044
rbcL: U04176
GenBank Accession
Number
rbcL: AF099687
LSU: EU349097
rbcL: DQ374331
rbcL:EU349107
rbcL: AF385653
rbcL: AY294397
LSU: EU349092
LSU: EU349106
B. Gavio & B. Wysor,
10 Aug 2000
rbcL: U02984
LSU: AF097883
rbcL: AY294358
C. F. D. Gurgel, 13 Feb 1998 LSU: AF259415
M. H. Hommersand,
7 Nov 1993
N. Arakaki, 30 Aug 2003
J. A. West, 19 Sep 2000
J. Cabioch, 22 Jun 1993
S. Fredericq & M. E.
Ramı́rez, 24 Feb 1994
J. A. West, 1 May 1993
rbcL: AF029140
rbcL: AF212188
LSU: AF419112
C. F. D. Gurgel, 11 Feb 1998 rbcL: AF259497
LSU: AF259407
B. Wysor, 19 Oct 1999
rbcL: AY168662
J. Rueness, s.d.
D. W. Freshwater,
29 Apr 1993
C. A. Maggs, 9 Feb 1993
M. H. Hommersand, 8 Aug
1997
D. W. Freshwater, Mar 1991
Collection Data
Table 2.—List of species used in the rbcL and LSU rDNA analyses with collection information and GenBank accession numbers.
368
PROCEEDINGS OF THE BIOLOGICAL SOCIETY OF WASHINGTON
Port MacDonnell, Australia
Botany Beach, Vancouver I., British Columbia,
Canada (#MJW-10276, #DMK-257)
Pigeon Point, San Mateo Co., California, U.S.A. M. H. Hommersand, 21 Dec
1992
United Kingdom
C. A. Maggs, 1996
Manomet Bluffs, Plymouth Co, Massachusetts,
M. H. Hommersand, 23 Apr
U.S.A. (#DMK-258)
1993
Bodega Head, Sonoma Co., California, U.S.A.
M. H. Hommersand, 23 May
1992
Ketchikan, Alaska, U.S.A.
S. C. Lindstrom, 2 Jul 2000
Penmarch, Brittany, France
M. H. Hommersand, 21 Dec
1992
Pigeon Pt., San Mateo Co., California, U.S.A.
M. H. Hommersand, 21 Jun
(#LAF-6-21-92-1-1, #DMK-250)
1992
Freshwater & Bailey 1998
Freshwater & Bailey 1998
Santec, Brittany, France
J. Cabioch, 6 Apr 1993
Botany Bay, Vancouver I., British Columbia,
M. J. Wynne, 11 Jul 1995
Canada (#MJW-10268)
Murroran, Hokkaido, Japan (#LAF-9-6-93-1-1) S. Fredericq, 6 Sep 1993
Seal Rock, Lincoln Co., Oregon, U.S.A.
E. C. Henry, 24 May 1993
Italy, s.n.
E. Cecere, 25 Jul 1994
Anse de Caro, Brittanny, France
Coll. J. Cabioch, 3 Jul 2000
Le Gall & Saunders 2007
Dilsea californica (J. Agardh) Kuntze
Gloiopeltis tenax (Turner) Decaisne
Gloiosiphonia verticillaris Farlow
Gracilaria bursa-pastoris (S. G. Gmel.) P. C. Silva
Gracilaria bursa-pastoris (S. G. Gmel.) P. C. Silva
Gracilaria salicornia (C. Agardh) E. Y. Dawson
Gelidiella acerosa (Forsskål) Feldmann & G. Hamel
Gelidium pusillum (Stackh.) Le Jolis
Gigartina pistillata (S. G. Gmel.) Stackh.
Gloiopeltis furcata (Postels & Ruprecht) J. Agardh
Gastroclonium subarticulatum (Turner) Kütz.
Fauchea laciniata J. Agardh
Furcellaria lumbricalis (Hudson) Lamouroux
Endocladia muricata (Postels & Ruprecht) J. Agardh
Dudresnaya verticillata (Withering) Le Jolis
Dumontia contorta (S. G. Gmel.) Ruprecht
Dilsea californica (J. Agardh) Kuntze
rbcL: U04037
rbcL: EU349207
LSU: EU349088
GenBank Accession
Number
rbcL: EU349110
rbcL: UO4196
LSU: EU349099
rbcL: AY049375
LSU: EF033615
LSU: AF039551
LSU: AF039542
rbcL: AY294375
rbcL: EU349109
LSU: EU349100
rbcL: AY294355
rbcL: AY294371
rbcL: EU349215
rbcL: AY294378
LSU: EU349094
rbcL: UO4193
rbcL: UO4192
S. Fredericq & M. E
Ramı́rez, 9 Feb 1994
M. H. & F. Hommersand, 28 rbcL: AY294379
Aug 1995
M. J. Wynne, 17 Jan 1996
LSU: EU349093
LSU: AF419133
LSU: EF033603
rbcL: U26812
C. F. D. Gurgel, 12 Dec 1998 rbcL: AF488813
Dicranema revolutum (C. Agardh) J. Agardh
Cryptonemia undulata Sonder
Delisea hypneoides Harvey
Delisea pulchra (Greville) Mont.
Cryptonemia luxurians (C. Agardh) J. Agardh
S. Fredericq & S. M. Lin, 26
Aug 1993
Collection Data
UTEX culture collection #1553
epiphytic on Cladophora, Fong Chei Sa,
Kenting Natl. Park, S. Taiwan, (#
LAF-8-26-93-2-2, #DMK-246)
Praia Rasa, Rio de Janeiro, Brazil
(#LAF-12-12-98-1-1)
Harper & Saunders 2001
Le Gall & Saunders 2007
King George I., Antarctic Peninsula
Collection Locality
Compsopogon caeruleus (Balbis ex C. Agardh) Mont.
Contarinia okamurae Segawa
Species
Table 2.—Continued.
VOLUME 122, NUMBER 3
369
Tarcoola Beach, Australia (#LAF-9-21-95-1-1)
Harper & Saunders 2002b
Harper & Saunders 2002b
Sand Key, Florida Keys, Florida, U.S.A.
Kallymenia cribrosa Harvey
Kallymenia limminghii Mont.
Kallymeniopsis oblongifructa (Setchell) G. I. Hansen
Liagora valida Harvey
Nizymenia australis Sonder
Lomentaria hakodatensis Yendo
Mastocarpus papillatus (C. Agardh) Kütz.
Mychodea hamata Harvey
Nemastoma canariense (Kütz.) Mont.
Nesophila hoggardii W. A. Nelson & N. M. Adams
Lomentaria catenata Harvey
Palm Beach, KwaZulu-Natal, South Africa
J. N. Norris, R. H. Sims, &
S. Reed, 4 Nov 1989
Tokawa, Choshi, Japan (#LAF-9-2-93-1-2,
S. Fredericq & M. Yoshizaki,
#DMK-248)
Sep 1993
Kermelehen (Plouezoch), Brittany, France
J. Cabioch, 12 Jun 1994
Dichato, Concepcı́on, Chile (#LAF-3-30-93-1-1) M. E. Ramı́rez, 30 Mar 1993
Port MacDonnell, Australia, 14 Jul 1995
M. H. Hommersand
Canary Islands
R. Haroun, s.d.
W. side of Matu Kapiti I., New Zealand
W. Nelson, 20 Dec 1994
(#LAF-12-20-1994-1-1, #DMK-244)
Warrnambool, Victoria, Australia
M. H. Hommersand, 13 Jun
1995
rbcL: AY294380
LSU: EU349095
rbcL: AF212191
rbcL: AY294370
rbcL: EU349210
LSU: EU349089
rbcL: AF212192
2LSU: EU349101
LSU: AY171612
LSU: AY171613
rbcL: EU349112
rbcL: EU349216
rbcL: EU349111
rbcL: AF534407
rbcL: AY028817
rbcL: AF257368
Sherwood & Sheath 2003
Sherwood et al. 2002
Wemeldinge, Zeeland, The Netherlands
F. & M. H. Hommersand,
7 Aug 1997
M. H. Hommersand, 23 Jul
1993
M. H. & F. Hommersand,
21 Sep 1995
rbcL: AF534409
Sherwood & Sheath 2003
rbcL: AF259494
rbcL: AF488820
rbcL: U04173
rbcL: AY294361
LSU: EU349103
rbcL: AY049415
rbcL: AY049434
GenBank Accession
Number
Hildenbrandia angolensis Welwitsch ex W. West &
G. S. West
Hildenbrandia crouanii J. Agardh
Hildenbrandia rivularis (Liebmann) J. Agardh
Hypoglossum hypoglossoides (Stackh.) F. S. Collins &
Hervey
Jania natalensis Harvey
C. Acleto & R. Zuninga,
3 Mar 1994
S. Guimarães & M. Fujii,
15 Sep 2001
S. Fredericq, 6 Sep 1993
E. C. Henry, 24 May 1993
S. M. Guimarães & M. Fujii,
17 Sep 2001
M. H. Hommersand,
20 Jun 1993
C. J. Bird, 3 Jul 1999
Collection Data
Penmarch, Brittany, France
Marataizes, Espiritu Santo, Brazil
(#LAF-9-15-01-1-1, #DMK-251)
Muroran, Hokkaido, Japan
Seal Rock, Lincoln Co., Oregon, U.S.A.
Parati Beach, Anchieta, Espiritu Santu, Brazil
Pomquet harbor, Antigonish Co., Nova Scotia,
Canada
Yacilla, Paita, Piura, Peru
Collection Locality
Heterosiphonia plumosa (Ellis) Batters
Grateloupia turuturu Yamada
Halosaccion glandiforme (S. G. Gmel.) Ruprecht
Halymenia floridana J. Agardh
Gracilariopsis lemaneiformis (Bory de St. Vincent)
E. Y. Dawson, Acleto & Foldvik
Grateloupia dichotoma J. Agardh
Gracilaria tikvahiae McLachlan
Species
Table 2.—Continued.
370
PROCEEDINGS OF THE BIOLOGICAL SOCIETY OF WASHINGTON
Collection Locality
King George I., Antarctic Peninsula
Penmarch, Brittany, France
Taiwan
Fort Fisher, New Hanover Co., North Carolina,
U.S.A.
Valentin & Zetsche 1989
Plocamium sp.
Polyides rotundus (Hudson) Greville
Polyopes polyideoides Okamura
Porphyra carolinensis J. Coll & J. Cox
Porphyridium aerugineum Geitler
Mosteiros, São Miguel, Azores (#SMG-04-117)
Spiddall, Co. Galway, Ireland
The Kowie, Port Alfred, South Africa
Platoma cyclocolpum (Mont.) F. Schmitz
Plocamium cartilagineum (L.) P. S. Dixon
Plocamium corallorhiza (Turner) Harvey
Nizymenia conferta (Harvey) Chiovitti, G. W. Saunders Warrnambool, Victoria, Australia
& Kraft
(#LAF-7-13-95-1-1)
Ochtodes secundiramea (Mont.) Howe
Baie Olive, Guadeloupe, French West Indies
(#LAF-3-10-94-1-1, #DMK-245)
Palmaria palmata (L.) Kuntze
Skerries, Co. Dublin, Northern Ireland
Paralemanea annulata (Kütz.) M. L. Vis &
Orange Co., North Carolina, U.S.A.
R. G. Sheath
Peyssonnelia bornetii Boudouresque & Denizot
Portofino, Italy, 2–20 m (#LAF-7-28-01-1-2,
#DMK-218)
Peyssonnelia replicata Kütz.
Trafalgar Beach, KwaZulu-Natal, South Africa
(#LAF-2-6-01-2-2, #DMK-241)
Peyssonnelia rubra (Greville) J. Agardh
Sestri Levante, Italy, 3 m (#LAF-8-2-01-1-1,
#DMK-166)
Peyssonnelia squamaria (S. G. Gmel.) Decaisne
São Miguel, Azores (#SMG-05-152, #
DMK-164)
Peyssonnelia squamaria (S. G. Gmel.) Decaisne
Catalunya, Spain (#CAT-06-10, #DMK-230)
Phacelocarpus sessilis J. Agardh
Warrnambool, Victoria, Australia (#
LAF-7-13-95-1-1)
Phacelocarpus tortuosus Endlicher & Diesing
Shark’s Bay, The Kowie, Port Alfred, Cape
Prov., South Africa
Phyllophora crispa (Hudson) P. S. Dixon
Spidall, Co. Galway, Ireland
Phyllophora pseudoceranoı̈des (S. G. Gmel.)
Woods Hole, Massachusetts, U.S.A. (#SLF-57)
Newroth & A. R. A. Taylor
Platoma chrysymenioides Gavio, Hickerson
Dredged offshore Louisiana, U.S.A.,
& Fredericq
28u03.4929N, 92u27.6659W (60 m depth)
Species
Table 2.—Continued.
rbcL: EU349175
rbcL: EU349114
D. Gabriel, 10 Oct 2005
D. Gabriel, 16 Jul 2006
M. H. Hommersand, 13 Jul
1995
M. H. Hommersand, 19 Jun
1993
M. D. Guiry, 7 Mar 1993
M. H. Hommersand, 1995
S. Fredericq, B. Gavio,
C. F. D. Gurgel, & J.
Lopez-Bautista, 27 May
2000
D. Gabriel, 5 Jun 2004
M. D. Guiry, 28 Feb 1993
M. H. Hommersand, 19 Feb
1993
S. Fredericq, 5 Feb 1994
M. H. Hommersand, 20 Jun
1993
rbcL: EU349178
B. Gavio, 2 Aug 2001
rbcL: X17597
rbcL: AF385643
rbcL: U04041
rbcL: U26818
rbcL: UO4214
LSU: FJ655936
rbcL: U21701
rbcL: U26817
rbcL: AY294362
rbcL: U02990
LSU: EU349096
rbcL: AY294372
rbcL: EU349179
Tom Schilz, 6 Feb 2001
rbcL: EU349209
LSU: EU349086
rbcL: U04186
rbcL: U04038
rbcL: EU349113
GenBank Accession
Number
rbcL: EU349181
LSU: EU349076
rbcL: EU349182
B. Gavio, 28 Jul 2001
M. H. Hommersand, 13 Jul
1995
A. Renoux, 10 Mar 1994
Collection Data
VOLUME 122, NUMBER 3
371
Collection Locality
Magang Harbor, NE Taiwan
(#LAF-8-11-93-3-20)
Portieria hornemannii (Lyngbye) P. C. Silva
South Africa
Portieria japonica (Harvey) P. C. Silva
Tokawa, Choshi, Chiba Pref. Japan
(#LAF-5-22-93-1-1, #DMK-247)
Portieria tripinnata (Hering) De Clerck
Palm Beach, KwaZulu-Natal, South Africa
(#LAF-2-5-01-3-1)
Predaea goffiana Ballantine, Ruiz & Aponte
Campeche Banks, Mexico, 22u07.439N,
91u22.859W, 40 m (#LAF-6-17-05-4-1)
Predaea laciniosa Kraft
Hawaii, U.S.A. (#SLF-937)
Pseudolitophyllum muricatum (Foslie) Steneck & R. T. Botanical Beach, Vancouver, British Columbia,
Paine
Canada
Pterocladia lucida (Brown ex Turner) J. Agardh
Owhiro Bay, South Wellington, New Zealand
Pterocladiella capillacea (S. G. Gmel.) Bornet
Torre a Mare, Bari, Italy
Ptilophora leliaertii Tronchin & De Clerck
Freshwater & Bailey 1998
Renouxia antillana Fredericq & J. N. Norris
Jamaica
Rhodogorgon carriebowensis J. N. Norris & Bucher
St. Ann’s Bay, Jamaica
Rhodopeltis borealis Yamada
Hwa Pin Yen, Hsiao Liuchiu I., Taiwan
Rhodymenia pseudopalmata (J. V. Lamouroux)
Port Aransas jetty, Texas, U.S.A.
P. C. Silva
(#LAF-5-17-98-1-1, #DMK-249)
Sarcodia ceylanica Harvey ex Kütz.
Wan Li Dung, Kenting Natl. Park, S. Taiwan
(#LAF-8-25-93-1-4)
Sarcodia montagneana (Hooker f. & Harvey) J. Agardh Taipa, New Zealand
Schizymenia apoda (J. Agardh) J. Agardh
São Miguel, Azores (#SMG-05-259)
Schizymenia dubyi (Chauvin ex Duby) J. Agardh
Piguet, Brittany, France
Solieria chordalis (C. Agardh) J. Agardh
Rade de Brest, Brittany, France
(#Deslandes-3-1-95)
Solieria filiformis (Kütz.) P. W. Gabrielson
Isla Culebra, Balboa, Pacific Panama
(#LAF-4-4-99-1-1)
Sonderopelta capensis (Mont.) comb. nov. herein
Salmon Banks, KwaZulu-Natal, South Africa,
30 m (#LAF-2-6-01-11, #DMK-215)
Sonderopelta coriacea Womersley & Sinkora
Warrnambool, Australia (#LAF-7-13-95-1-1,
K220)
Sphaerococcus coronopifolius Stackh.
Finavarra, Co. Clare, Ireland
Spyridia clavata Kütz.
Vero Beach, Indian River Co., Florida, U.S.A.
(#LAF-9-1-04-1-1, #TC-2070)
Titanophora incrustans (J. Agardh) Børgesen
offshore Louisiana, U.S.A., 28u06.4709N,
90u55.3599W, 58 m
Portieria hornemannii (Lyngbye) P. C. Silva
Species
Table 2.—Continued.
rbcL: AF212185
GenBank Accession
Number
rbcL: EU349187
LSU: EU349081
rbcL: EU349190
LSU: EU349082
rbcL: AY294376
rbcL: EU349108
S. Fredericq & O. De Clerck,
6 Feb 2001
M. H. Hommersand, 13 Jul
1995
M. D. Guiry, 7 Feb 1993
Tae Oh Cho, C. F. D. Gurgel,
& J. N. Norris, 1 Sep 2004
S. Fredericq & J. LopezBautista, 30 Jun 2001
rbcL: AY294365
rbcL: AY294356
B. Wysor, 4 Apr 1999
rbcL: U01048
rbcL: U01888
LSU: AF039547
C. Pueschel, s.d.
rbcL: U04181
C. Pueschel, s.d.
rbcL: U04183
S. Fredericq, 23 Aug 1993
rbcL: U26824
C. F. D. Gurgel, 17 May 1998 rbcL: AY168656
LSU: EU349102
S. Fredericq & S. M. Lin, 25 rbcL: U26819
Aug 1993
W. Nelson, 2 Jul 1993
rbcL: AY294374
D. Gabriel, 21 Sep 2005
LSU: EU349104
J. Cabioch, s.d.
rbcL: AY294389
E. Deslandes, 3 Jan 1995
LSU: EU349098
LSU: EU349105
rbcL: AY294373
P. Vroom, 21 Jul 2003
P. Gabrielson, 8 Jun 1994
W. Nelson, s.d.
E. Cecere, s.d.
rbcL: EU349115
S. Fredericq, 17 Jun 2005
rbcL: EU349206
rbcL: U26825
LSU: EU349087
D. W. Freshwater, 5 Feb 2001 rbcL: EU349205
S. Fredericq & S. M. Lin, 11
Aug 1993
M. H. Hommersand
M. Yoshizaki, 22 May 1993
Collection Data
372
PROCEEDINGS OF THE BIOLOGICAL SOCIETY OF WASHINGTON
VOLUME 122, NUMBER 3
belong to the Peyssonneliaceae sensu
stricto, i.e., Peyssonnelia and Sonderopelta, and an additional 77 samples are
representatives of the other major red
algal orders: Acrochaetiales, Ahnfeltiales,
Bangiales, Batrachospermales, Bonnemaisoniales, Ceramiales, Compsopogonales, Corallinales, Cryptonemiales, Gelidiales, Gracilariales, Hildenbrandiales,
Palmariales, Plocamiales, Porphyridiales,
Rhodymeniales, Nemaliales, Nemastomatales, Rhodogorgonales, and Gigartinales. The Gigartinales sensu stricto is
defined herein to include just the Gigartinaceae and Phyllophoraceae; and, the
Gigartinales sensu lato includes the following groups: Dumontiaceae complex (including the Dumontiaceae, Kallymeniaceae, Polyidaceae, Rhizophyllidaceae),
Solieriaceae complex (including the Caulacanthaceae, Cystocloniaceae, Dicranemataceae, Furcellariaceae, Mychodeaceae,
Solieriaceae), and the Sphaerococcaceae
complex (including the Endocladiaceae,
Nizymeniaceae, Phacelocarpaceae, Sphaerococcaceae). Porphyridium aerugineum
Geitler, representing the Porphyridiales,
was used as the outgroup based on
phylogenetic hypotheses derived from
earlier global analyses of the Rhodophyta
(e.g., Freshwater et al. 1994, Saunders &
Hommersand 2004, Yoon et al. 2006).
The second dataset contains 40 LSU
rDNA sequences, including four sequences
of Peyssonneliaceae sensu stricto and 36
sequences representing red algae belonging to the Acrochaetiales, Ahnfeltiales,
Bonnemaisoniales, Ceramiales, Compsopogonales, Cryptonemiales, Gelidiales,
Gigartinales [including Gigartinales sensu
stricto, and the Dumontiaceae-complex,
and Solieriaceae-complex], Gracilariales,
Rhodymeniales, and Nemastomatales.
Two of the Acrochaetiales, Acrochaetium
secundatum (Lyngbye) Nägeli and Audouinella hermannii (Roth) Duby, were used as
the outgroup.
Parsimony-derived trees for each of the
two data sets were inferred from a
373
heuristic search, excluding uninformative
characters, consisting of 1000 random
sequence additions holding 25 trees at
each step, and the tree-bisection-reconnection (TBR) swapping algorithm. Support for nodes in the MP were assessed by
calculating bootstrap proportion (BP)
values (Felsenstein 1985) as implemented
in PAUP* by generating 1000 bootstrap
data sets, from resampled data, with 1000
random sequence additions.
Optimal models of sequence evolution
to fit the data alignment estimated by
hierarchical likelihood ratio tests were
performed by Modeltest v.3.6 (Posada &
Crandall 1998). The model of sequence
evolution chosen for data files was the
GTR + I + G (General Time Reversible
model with variable base frequencies,
symmetrical substitution matrix). A ML
phylogram was generated for each of the
two data sets, using the substitution
model, gamma distribution, and proportion of invariable sites determined by the
model. For each data file, the ML tree
and 1000 bootstrap trees were inferred by
PhyML 3.0, using the Nearest Neighbor
Interchange (NNI) branch swapping
method.
The optimal model of sequence evolution obtained for each data set was used
to set up the Markov Chain Monte Carlo
(MCMC) search for the Bayesian analyses. Four chains of the (MCMC) were
run, sampling one tree every 100 generations for 2,000,000 generations starting
with a random tree for each of the two
data files. The analyses phylogenic inferences were based on the trees sampled
after the ‘‘burn in’’ point. A 50% majority
rule concensus, as implemented by
PAUP*, was computed from those saved
trees. This frequency corresponds to the
posterior probability of the clades.
Morphological studies.—Voucher specimens (Table 2) for morphological studies
and phylogenetic analyses were liquidpreserved in 5% buffered Formalin/seawater, and/or pressed and air-dried on
374
PROCEEDINGS OF THE BIOLOGICAL SOCIETY OF WASHINGTON
herbarium sheets, and deposited in the
herbaria of the University of Louisiana at
Lafayette (LAF) and the Algal Collection
of the US National Herbarium (US);
herbaria abbreviations follow Holmgren
et al. (1990); taxon author names follow
Brummitt & Powell (1992). Specimens
that were sectioned for observation by a
light microscope were stained with a 1%
aqueous aniline blue acidified with 0.1%
diluted HCl (Tsuda & Abbott 1985).
Species identifications were based on
original descriptions and critical comparisons of the literature (e.g., Taylor 1960,
Denizot 1968, Boudouresque & Denizot
1975, Abbott & Hollenberg 1976, Schneider & Reading 1987) and, where possible,
type specimens and topotype material
were studied using the type method (Silva
1952, Silva et al. 1987).
ducing specialized calcified cells (cystoliths) within the thallus (Fig. 1C).
Reproduction.—Gametophytic thalli are
monoecious or dioecious, with gametangia
in nemathecia intermixed with paraphyses.
Spermatangial branches erect, bearing abundant spermatangia (Fig. 1K). Carpogonial
branches (Fig. 1J) 3–6 celled; auxiliary cells
intercalary in 3–6 celled auxiliary cell
branches. Gonimoblasts (Fig. 1L) formed
from site of fusion of connecting filament
segment to diploidized auxiliary cell. Tetrasporangia in nemathecia (Fig. 1H), cruciate
(Fig. 1I), usually terminal on filaments
intermixed with paraphyses.
Habitat.—Growing predominately on
rocks, shells, coralline crusts, corals, coral
rubble, and other hard substrata; intertidal, and/or shallow to deep subtidal, to
depths of 288 m.
Results
Sonderopelta Womersley & Sinkora,
1981:85 (Fig. 3)
Sonderopelta coriacea Womersley &
Sinkora, 1981:85 (Generitype)
Comparative morphological studies
of the generitypes of Peyssonnelia
and Sonderopelta
Peyssonnelia Decaisne, 1841:168 (Figs. 1, 2)
Peyssonnelia squamaria (S. G. Gmelin)
Decaisne, 1841:168 (Generitype).
Basionym: Fucus squamarius S. G. Gmelin, 1768:171, pl. XX: figs. 1A, B.
Thallus.—Prostrate (Fig. 1A, B, M),
crustose, 70–500 mm thick, entire thallus
tightly adherent to loosely attached to
substratum by unicellular or multicellular
rhizoids (Fig. 1O) to basally attached to
substratum with most of thallus free
floating. Thallus generally of two distinct
layers: a unistratose hypothallus, and a
multistratose perithallic layer (Fig. 1C);
presence of subhypothallic layer in certain
species (Fig. 1G, N). Dorsal and ventral
surfaces of the thallus formed by cortical
cells of the perithallus (Fig. 1E) and
hypothallus (Fig. 1F), respectively. Species either lack, or contain hypobasal
calcification (Fig. 1D), with some pro-
Thallus.—Prostrate, crustose (Fig. 3A),
cartilaginous, 0.5–1.5 mm thick (Fig. 3B),
loosely attached to substratum, lacking or
with regionalized calcification. Thallus with
a stipe-like, dense interwoven mass of
multicellular rhizoids (Fig. 3H–J) beneath
the thallus, proximally becoming wider and
fan-like (Fig. 3E, F) in appearance. Thallus
multiaxial, internally composed of several
cell rows that form the dorsal (Fig. 3C) and
ventral (Fig. 3D) surfaces. Dorsal surface
cells isodiametric (Fig. 3D, G), all other
cells elongate (Fig. 3E, F).
Reproduction.—Reproductive thalli not
observed in this study.
Habitat.—Growing on rocks; shallow
subtidal at depths of 1.0–25 m.
Molecular phylogenetic analysis of Peyssonneliaceae and its placement within
the Florideophyceae
Using, respectively, Porphyridiales and
Acrochaetiales as outgroups, rbcL and
VOLUME 122, NUMBER 3
nuclear LSU rDNA phylogenies reveal
strongly defined clades of Peyssonneliaceae (Figs. 4–7). The Maximum Parsimony results (Fig. 4) are broadly congruent
with the Bayesian and Maximum Likelihood results (Fig. 5); the MB posterior
probabililty values have been added to the
ML tree (Fig. 5). In general, each major
clade at ordinal rank is well supported
based on bootstrap replicates or posterior
probability values, but many interordinal
or family-complex relationships are unresolved. The Peyssonneliaceae species cluster into two clades (Figs. 4–7), the Peyssonnelia and Sonderopelta clades, well
supported by both datasets and all
analyses.
In a global analysis of red algae, the
MP analysis of rbcL (Fig. 4) strongly
supports (MP 5 85) the monophyly of
the Peyssonneliaceae, as does the ML
(ML 5 99) (Fig. 5) and Bayesian analyses
(MB 5 100) (Fig. 5). The MP and ML
analyses (Figs. 4, 5) do not provide
support for a clear sister relationship
between the Peyssonneliaceae and other
red algal groups; however, the family
forms a well-supported grade with the
Kallymeniaceae, Rhizophyllidaceae, and
Dumontiaceae with MB (MB 5 100) but
not with the Polyidaceae (Fig. 5), which
strongly clusters with the Sphaerococcaceae under Bayesian inference (MB 5 93).
In the MP (Fig. 4) and ML (Fig. 5)
analyses, the sister relationship of the
Polyidaceae is unsupported.
The LSU rDNA (Figs. 6, 7) datasets
strongly support the monophyly of the
Peyssonneliaceae with full support in the
MP (Fig. 6), and ML and MB analyses
(Fig. 7). In MP, the sister relationship to
the Peyssonneliaceae remains unresolved
(Fig. 6), and the family clusters weakly in
a clade comprising Kallymeniaceae, Dumontiaceae, Rhizophyllidaceae in the ML
analysis (ML 5 70) and in the Bayesian
analysis (MB 5 64) (Fig. 7).
Bootstrap and posterior probability
support for relationships forming the
375
backbone of the red algae are nonexistent. In all analyses, the Solieriaceae,
Mychodeaceae, Cystocloniaceae, Caulacanthaceae, Dicranemataceae, and Furcellariaceae cluster together in a clade
with either no (MP , 50) (Fig. 4), weak
(ML 5 77) (Fig. 5) or full support (MB 5
100). There is no support for a sister
relationship of the Gigartinaceae and
Phyllophoraceae to other groups of red
algae in the MP (Fig. 4), ML, and MB
(Fig. 5) trees.
A complex of families comprising the
Sphaerococcaceae, Nizymeniaceae, Phacelocarpaceae, Gloiosiphoniaceae, and
Endocladiaceae form a group, without
support in the MP (Fig. 4) and ML
(Fig. 5) analyses. There is weak (ML 5
75) support in the ML analysis and full
support in the Bayesian analysis (Fig. 5)
for this cluster of families, excluding the
Sphaerococcaceae.
The Cryptonemiales and Rhodymeniales form a sister relationship, without
support, in the MP (Fig. 4) and ML
(Fig. 5) rbcL trees but with full support in
the MB analysis (Fig. 5). The position of
the Nemastomatales to the Cryptonemiales and Rhodymeniales is equivocal;
it is nested in a supergroup encompassing the Cryptonemiales, Rhodymeniales,
Gracilariales, Gelidiales, and Ceramiales
in MB with strong support (MB 5 99)
but with no support in ML (Fig. 5). The
topological position of the Nemastomatales, Ceramiales and remaining red algal
orders in the rbcL MP and LSU rDNA
(MP) (Fig. 6), and ML and MB trees
(Fig. 7) are either not resolved or remain
equivocal.
Discussion
Morphological conclusions.—Members
of the Peyssonneliaceae share a crustose
habit and nemathecial reproductive structures with some members of the Gigartinales; however, the development of
carpogonial branches and auxiliary cell
376
PROCEEDINGS OF THE BIOLOGICAL SOCIETY OF WASHINGTON
Fig. 1. Morphology of Peyssonnelia. A, Dorsal habit of thallus in P. squamaria; scale bar 5 1.0 cm. B,
Dorsal habit of thallus in P. replicata; scale bar 5 1.0 cm. C, Thallus RVS (radial vertical section),
illustrating a stone cell (cystolith), within perithallic filaments, and perithallial and hypothallial regions of
thallus in P. rubra. D, Thallus RVS, showing rhizoids and demonstrating presence of hypobasal calcification
in P. rubra. E, Dorsal view of thallus surface in P. bornetii. F, Ventral view of thallus surface in P. bornetii.
G, Thallus RVS, illustrating perithallial, hypothallial, and subhypothallial regions in P. squamaria. H,
VOLUME 122, NUMBER 3
branches differs markedly among groups.
In the Polyidaceae, Rhizophyllidaceae,
and in Rhodopeltis, these branches originate from a surface cell, in contrast to
their lateral origin from an intercalary
cortical cell in the Peyssonneliaceae. In all
Rhizophyllidaceae and in Rhodopeltis, the
carpogonial and auxiliary cell branches
stop growth at the 3–(4) -celled stage
beyond the outline of the original cortex.
In contrast, in the Polyidaceae, carpogonial branches form only after the sterile
filaments of the nemathecium reach a
stage of 10–12 cells in length, then
specific, shorter filaments develop carpogonia (Rao 1956). Typically, nuclei in
both the basal cells of the carpogonial
branch in the Rhizophyllidaceae, Polyidaceae and in Rhodopeltis become enlarged before fertilization, as do the cells
flanking the auxiliary cell. In addition,
these cells increase in size prior to
fertilization (Wiseman 1977:figs. 1–11;
Hommersand & Fredericq 1990:figs. 74,
75; Nelson & Adams 1993:fig. 9). In
contrast to the Polyidaceae and Rhizophyllidaceae, carpogonial branches of the
Peyssonneliaceae originate laterally on an
intercalary cell of a nemathecial filament
only after the nemathecium is fully
developed; thus, they are formed secondarily (see Schneider & Reading 1987). The
basal cells of the unfertilized carpogonial
branches do not increase considerably in
size (e.g., Guimarães & Fujii 1999:fig. 18)
in contrast to those of the auxiliary
branch (e.g., Hommersand & Fredericq
1990:fig. 77).
377
Kylin (1956) placed the Rhizophyllidaceae, Polyidaceae, and Peyssonneliaceae
in the order Cryptonemiales, noting that
the entire nemathecial structure in these
families consists of accessory filaments,
thus by definition the auxiliary cell
branches are accessory as well. Papenfuss
(1966), however, characterized the auxiliary cell branch in the Polyidaceae, which
at that time included Rhodopeltis, as
vegetative or non-accesssory, and Wiseman (1975) likewise interpreted the auxiliary cell branches of the Rhizophyllidaceae as homologous in position to those
of a vegetative branch and hence nonaccessory in origin. Both of these families
were subquently transferred to the Gigartinales by the latter authors.
Nemathecial pustules are deceptively
similar structures that arose more than
once in red algae. Molecular data confirm
the non-homology between nemathecia in
the Peyssonneliaceae, and those of the
Rhizophyllidaceae and the Polyidaceae.
The Polyidaceae (Rao 1956), Rhizophyllidaceae (Wiseman 1977), and the genus
Rhodopeltis (Nozawa 1970; Itono &
Yoshizaki 1992a, b) share a common
reproductive strategy in which the fertilized carpogonium first fuses with an
intercalary cell of the carpogonial branch
before forming a fusion cell product that
may subsequently send out multiple
connecting filaments that contact auxiliary cells in separate accessory filaments.
Ochtodes J. Agardh (Rhizophyllidaceae)
has been reported as both a procarpic and
non-procarpic genus (Wiseman 1977), but
r
Tetrasporophyte thallus RVS, showing a nemathecium in P. squamaria. I, Multicellular paraphyses and
cruciately divided tetraspores of nemathecium in P. squamaria. J, Gametophytic thallus RVS, illustrating
three-celled carpogonial branch in P. dubyi; scale bar 5 5.0 mm. K, Gametophytic thallus RVS, showing
spermatangial branch in P. dubyi; scale bar 5 5.0 mm. L, Gametophyte thallus RVS, demonstrating
carpospores in P. dubyi; scale bar 5 5.0 mm. M, Ventral habit of thallus of P. squamaria; scale bar 5 1.0 cm.
N, Thallus RVS, illustrating presence of rhizoids in P. coriacea. O, Branched multicellular rhizoids in P.
bornetii. [Figs. A, G–I, M from Gabriel SMG-05-242 (AZU); Fig. B from Schilz LAF-2-6-01-2-2 (LAF);
Figs. C, D from Gavio LAF-8-2-01-1-1 (LAF); Figs. E, F, O from Gavio LAF-7-28-01-1-2 (LAF); Figs. J–L
from Maggs s.n.; Fig. N from Gavio IT03-12 (LAF)].
378
PROCEEDINGS OF THE BIOLOGICAL SOCIETY OF WASHINGTON
Fig. 2. Morphology of Sonderopelta capensis. A, Dorsal habit of thallus; scale bar 5 0.5 cm. B, Thallus RVS,
demonstrating its thickness. C, Dorsal view of thallus surface. D, Ventral view of thallus surface. E, F, Thallus
RVS, showing perithallial and hypothallial regions. G, Thallus RVS, demonstrating a layer of short-celled erect
filaments at upper surface of thallus. H, Thallus RVS, illustrating cystoliths of perithallus in aggregations. I,
Ventral habit of thallus, dense aggregation of rhizoids showing tomentose condition throughout surface; scale
bar 5 0.8 cm. J, K, Thallus RVS, demonstrating hypobasal calcification and dense aggregation of rhizoids.
[Figs. A, I from Fredericq & De Clerck LAF-2-6-01-11 (LAF); Figs. B, E, F, K from Fredericq & De Clerck
LAF-2-6-01-5 (LAF); Figs. C, D, G, H, J from Fredericq & De Clerck LAF-2-6-01-l-18 (LAF)].
VOLUME 122, NUMBER 3
379
Fig. 3. Vegetative morphology of Sonderopelta coriacea. A, Dorsal habit of thallus; scale bar 5 2.0 cm.
B, Thallus RVS, demonstrating its thickness. C, Dorsal view of thallus surface. D, Ventral view of thallus
surface. E, F, Thallus RVS, showing multiaxial construction of thallus. G, Thallus RVS, illustrating layer of
short-celled erect filaments at upper thallus surface. H, Ventral habit of thallus, showing localized regions of
densely interwoven rhizoids (tomentose); scale bar 5 2.0 cm. I, Thallus RVS, containing dense aggregation
of rhizoids. J, Branched multicellular rhizoids. [Fig. A from Clarke 214, isotype of Sonderopelta coriacea
(US); Figs. B–J from Hommersand LAF-7-13-95-1-1 (LAF)].
380
PROCEEDINGS OF THE BIOLOGICAL SOCIETY OF WASHINGTON
Fig. 4. One of 48 most parsimonious trees based on rbcL sequences showing relationship of
Peyssonneliaceae to other major red algal orders. Numbers at each node represent (maximum parsimony
(MP) bootstrap values.
VOLUME 122, NUMBER 3
381
Fig. 5. Maximum-likelihood tree of rbcL sequence data showing relationship of Peyssonneliaceae to
other major red algal orders. Two tiers of numbers at each node; top numbers are maximum likelihood (ML)
bootstrap values and bottom numbers are maximum Baysian (MB) posterior probabilities.
we interpret Ochtodes as being similarly
non-procarpic even though the connecting filament may be reduced in size to a
short fusion process if the auxiliary cell is
spatially close to the carpogonium. In
contrast, the fertilized carpogonium in the
Peyssonneliaceae does not fuse with an
intercalary cell of the carpogonial branch
prior to initiating a connecting filament.
Sjöstedt (1926) placed the Polyidaceae
close to the Dumontiaceae based on the
shared character states of having separate
carpogonial and auxiliary cell branches,
and intercalary auxiliary cells but kept the
families separate based on presence or
absence of reproductive structures in
nemathecia. Whereas the phylogenetic
placement of the Polyidaceae is equivocal
382
PROCEEDINGS OF THE BIOLOGICAL SOCIETY OF WASHINGTON
Fig. 6. One of six most parsimonious trees based on LSU rDNA sequences showing relationship of
Peyssonneliaceae to other major red algal orders. Numbers at each node represent MP bootstrap values.
Fig. 7. Maximum-likelihood tree of LSU sequence data showing relationship of Peyssonneliaceae to
other major red algal orders. Two tiers of numbers at each node; top numbers are ML bootstrap values and
bottom numbers are MB posterior probabilities.
VOLUME 122, NUMBER 3
on the basis of the molecular data in the
restricted dataset (Figs. 4, 5), a close
systematic relationship between the Dumontiaceae and Rhizophyllidaceae, as
proposed by Kylin (1930), is corroborated. On the other hand, links between
these families and the Peyssonneliaceae
and Corallinaceae (Norris 1957), and a
proposed close relationship between the
Dumontiaceae and Gloiosiphoniaceae
(Kylin 1930, Abbott 1968), and between
the Dumontiaceae and Halymeniaceae
(Lewis & Kraft 1992) are refuted. A
thorough study of the Dumontiaceae
complex (i.e., Dumontiaceae, Kallymeniaceae, Polyidaceae, and Rhizophyllidaceae) will be done elsewhere; likewise a
major study on the Sphaerococcaceae
complex (i.e., Sphaerococcaceae, Nizymeniaceae, Phacelocarpaceae, Gloiosiphoniaceae, and Endocladiaceae) is forthcoming.
Molecular conclusions.—Both the rbcL
and LSU rDNA data suggest that the
Peyssonneliaceae, represented by Peyssonnelia and Sonderopelta, forms a wellsupported monophyletic unit within the
red algae. Phylogenies generated from the
rbcL and LSU rDNA molecular datasets
support the placement of the Peyssonneliaceae in its own order comparable to
other recognized red algal orders.
The molecular analyses presented herein
also corroborate earlier molecular studies.
First, the Gigartinales and Cryptonemiales
sensu Kylin (1956) are polyphyletic, and
some families (i.e., Rhizophyllidaceae, Dumontiaceae, and Kallymeniaceae) often
placed in either of these orders form a
clade. Second, the Plocamiaceae does not
belong in the Gigartinales and the molecular data supports recognition of the order
Plocamiales (Saunders & Kraft 1994,
Fredericq et al. 1996a), in a clade with the
Sarcodiaceae (Fredericq et al. 1996a,
Saunders et al. 2004). And finally, a clade
centered around the Halymeniaceae
(5Cryptonemiaceae), the type of the
Cryptonemiales (renamed Halymeniales
383
by Saunders & Kraft 1996), is allied to
the Rhodymeniales (Gavio et al. 2005).
Previous phylogenetic analyses revealed the following clades, constituting
in part the Gigartinales sensu lato (e.g.,
Schneider & Wynne 2007): 1) an assemblage referred to as the Dumontiaceae
complex (Fredericq et al. 1996b); 2)
families comprising the Solieriaceae complex (Fredericq et al. 1999, N’Yeurt et al.
2006); 3) the Gigartinales sensu stricto
with the Gigartinaceae (Hommersand et
al. 1994), and the Phyllophoraceae (Fredericq et al. 2003); 4) families centered
around the Sphaerococcaceae (Fredericq
et al. 1996b); and 5) the Peyssonneliaceae
(including the type species of Peyssonnelia). Many of these family complexes of
the Gigartinales sensu lato represent red
algal orders that are yet to be formally
described (Fredericq et al. pers. comm..).
The fact that some of these relationships
are not recovered with strong support in
the present rbcL and LSU rDNA analyses
is indicative of the restricted taxon
sampling of each of these monophyletic
groups when subjected to a global analysis of the red algae.
RbcL and LSU rDNA sequence analyses also suggest that two genera, Metapeyssonnelia and Polystrata, genera formerly placed in the Peyssonneliaceae, are
in all likelihood members of the Dumontiaceae complex (unpublished data, awaiting type material for confirmation). A
study of the Dumontiaceae complex will
be published separately to better assess
the placement of Metapeyssonnelia and
Polystrata within the red algae.
Additional taxonomic notes on Peyssonneliaceae.—The taxonomic history and
placement of this family is complicated.
Peyssonnelia Decaisne (1841:168, pl. V:
figs 16, 17, as ‘Peyssonellia’) is the type of
the Peyssonneliaceae Denizot. The generitype, Peyssonnelia squamaria (S. G.
Gmelin) Decaisne, 1842a:360 (basionym:
Fucus squamarius S. G. Gmelin, 1768:171,
pl. XX: fig. 1a, b (vide Decaisne,
384
PROCEEDINGS OF THE BIOLOGICAL SOCIETY OF WASHINGTON
1842b:126), was originally described in
the ‘‘family’’ Choristosporeae Descaisne.
Since then, generic placement has been
somewhat problematic. In the same year,
another genus Squamaria Zanardini
(1841:235), was described based on S.
vulgaris Zanardini and placed in its own
family Squamariaceae Zanardini (1841, as
‘‘order Squamarieae’’; see McNeill et al.
2006: Art. 18.3). Although Squamaria
Zanardini is taxonomically the same as
Peyssonnelia, since it is a later homonym
of the higher plant Squamaria Ludwig
(1757:120), it is an illegitimate name. Thus
Peyssonnelia Decaisne (1841) is the valid
name and correct spelling for the genus.
Hauck (1885) considered Peyssonnelia
to belong in its own family, the Squamariaceae Hauck, which is a homonym of
Squamariaceae Zanardini (1841), and
Squamariaceae J. Agardh (1851). However, the family name Squamariaceae, proposed by these three authors independently, is also illegitimate, since it was based on
an illegitimate generic name, Squamaria
Zanardini (1841). Nevertheless, Peyssonnelia was retained within the ‘‘Squamariaceae’’ for over 100 yr (e.g., Zanardini
1841, 1858; Agardh 1851, Kylin 1956),
until Denizot (1968, as ‘‘Peyssonneliacées’’) recognized the illegitimacy of the
name Squamariaceae and proposed Peyssonneliaceae as the replacement name for
the family (see also Silva 1980).
Taxonomic conclusions.—In addition to
the suite of reproductive characters that
circumscribe the Peyssonneliaceae, rbcL
and LSU rDNA have proven to be
adequate genes of choice to infer relationships among genera, families and
orders of red algae. Comparative gene
sequence analyses confirm that the Gigartinales and Cryptonemiales need to be
re-characterized and subdivided into several orders (Freshwater et al. 1994,
Saunders & Kraft 1994, 1996; Fredericq
et al. 1996b, Saunders et al. 2004). The
Peyssonneliaceae forms a monophyletic
assemblage that cannot be maintained in
the Gigartinales sensu lato, and thus
constitutes a distinct order, proposed
herein.
Peyssonneliales Krayesky, Fredericq, &
J. N. Norris, ord. nov.
Diagnosis.—Crustacea, prostrata, plerumque epilithica taxa, infernae paginae
omnino usque ad partialiter affixae substrato cum aut sine rhizoideis unicellulosis
aut multicellulosis. Species acalcareae omnino, aut saepe partialiter calcareae calcificatione hypobasali inter rhizoidea, aut
interdum calcareae omnino. Calcite si presens in forma mineralis aragoniti. Prostratum incrementum per radiatim marginales
series aut per initia apicalia divisa transversim in basali strato postea dividentia
verticaliter formantia singulares supernas
aut infernas perithalli cellulas. Cellulae
perithalli producentes filamenta simplicia
aut ramosa erecta, simul formantes corticem laxum usque ad compactum superum
inferumque aut superum solum (perithallus). Synapses continentes onturamenta
sine stratis capitularibus. Chloroplasti numerosi discoidei. Gametophyti monoecii
sed dioecii. Masculina nemathecia fasciculatis spermatangialibus filamentis formatis
apicalibus aut intercalaribus. Fila carpogonialia fila auxiliaresque ambo 3–6 cellularum longa genita lateraliter in filamentis
erectis in nematheciis, fila connectentia
saepe conniventia ad plus quam unicam
cellulam auxiliarem, formantes cellulas fusionales parvas usque ad extendentes ferentes gonimoblastos, pro parte maxima
cellulis evolvantibus in curtas, simplices,
aut ramosas catenas carposporangiorum.
Gonimoblasti formati aliter filis connectentibus. Tetrasporophyti gametophytique isomorphi. Tetrasporangia terminalia lateraliaque in nematheciis superficialibus cruciatim divisa inter paraphyses graciles
multicellularesque.
Description.—Crustose, prostrate, usually epilithic, with the lower surfaces
partially to completely attached to substratum, with or without unicellular or
VOLUME 122, NUMBER 3
multicellular rhizoids. Thalli non-calcified
throughout, or often partially calcified
with hypobasal calcification between the
attachment rhizoids, or sometimes calcified throughout. Calcium carbonate, if
present, in the mineral form aragonite.
Prostrate growth by radiating marginal
rows of transversely dividing apical initials in the basal layer, that later divide
vertically to form single upper or lower
perithallial cells. First order perithallial
cells give rise to simple or branched erect
filaments, and these together form a loose
to compact, upper and lower, or upper
only, cortex (perithallus) (Denizot 1968).
Ultrastructurally, pit plugs without cap
layers. Chloroplasts numerous; discoid or
ribbon-like in shape.
Tetrasporophytes and gametophytes
isomorphic. Gametophytes, where known,
monoecious or dioecious. Male nemathecia with spermatangial filament development apical and intercalary; growth sympodial or apical. Carpogonial branches
and auxiliary cell branches each 3–6 cells
long, borne laterally on erect filaments in
nemathecia; with connecting filaments
often attaching to more than one auxiliary
cell to form small to sprawling fusion cells
bearing gonimoblasts, with most cells
developing in short, simple, or branched
chains of carposporangia. Gonimoblasts
may also form directly from the connecting filament. Tetrasporangia cruciate; terminal or lateral in tetrasporic nemathecia;
multicellular paraphyses present or absent.
With one family, Peyssonneliaceae Denizot (1968), containing two genera,
Peyssonnelia and Sonderopelta.
Type.—Peyssonnelia squamaria (S. G.
Gmelin) Descaine, 1841:168 [basionym:
Fucus squamarius S. G. Gmelin, 1768:171,
pl. XX: figs. 1A, B].
In addition, one species, Peyssonnelia
capensis, is recognized to belong to
another genus of the Peyssonneliaceae
(Peyssonniales), and is here transferred to
Sonderopelta.
385
Sonderopelta capensis (Montagne)
Krayesky, comb. nov.
Basionym: Peyssonnelia capensis Montagne, Ann. Sci. Nat. Bot., ser. 3,
7:177. 1847.
Lectotype: #Drège 44, (PC). Type locality: Durban, South Africa (fide Papenfuss, 1952:175).
Homotypic synonym: Pterigospermum
capense (Montagne) Kuntze, Rev.
Gen. Pl. 2:914. 1891.
Heterotypic synonyms:
Peyssonnelia major Kützing (as ‘Peys
sonelia’) Flora 30:774. 1847.
Pterigospermum majus (Kützing)
Kuntze, Rev. Gen. Pl. 2:914. 1891.
Peyssonnelia australis Sonder, Linnaea
25(6):685. 1853.
Ethelia australis (Sonder) Weber-van
Bosse, Monogr.
Siboga-Exped. 59b:300. 1921
Sonderophycus australis (Sonder) Denizot, Alg. Florid. Encrout.: 260,
307. 1968.
Peyssonnelia australis Areschoug, Nova
Acta Regiae Soc. Sci. Upsal., ser. 3,
1:352. 1854.
Ralfsia major Kützing, Tab. Phyc. 9:32.
1859.
Peyssonnelia coccinea J. Agardh, Sp.
alg., 3(1):385. 1876.
Pterigospermum coccineum (J.
Agardh) Kuntze, Rev. Gen. Pl.
2:914. 1891.
Peyssonnelia gunniana J. Agardh, Sp.
alg., 3(1):387. 1876.
Description.—Thallus prostrate, thick,
cartilaginous, crustose and lobed (Fig.
2A), with upper surface dark red, and
lower surface pale-red; partly attached to
the substratum by tomentosely arranged,
multicellar rhizoids from ventral surface
(Fig. 2B, E, F, I–K), most of ventral
thallus unattached (free from substratum). Anatomically of two layers: a
ventral hypothallus, and a dorsal perithallus (Fig. 2B, E, F, J). Basal layer of
perithallus of ascending filaments at
386
PROCEEDINGS OF THE BIOLOGICAL SOCIETY OF WASHINGTON
angles of 20–30u in the lower and middle
perithallus, with the apical portions of
filaments in the upper perithallus bending
to a 90u angle (Fig. 2F, G). Perithallial
cells, elongated in basal layer, and isodiametric in upper layer (Fig. 2C, D, G).
Cystoliths present, forming globular aggregates of cone-shaped crystals in the
perithallus (Fig. 2B, G, H, J). Tetrasporangia in nemathecia on dorsal surface;
cruciate, usually terminal on filaments
intermixed with paraphyses. Gametangial
structures not observed.
Remarks.—Although Sonderopelta capensis is in general agreement with the
generitype S. coriacea, it lacks the
multiaxial growth and nemathecial filaments among its tetrasporangia as found
in S. coriacea. However, both the rbcL
and LSU rDNA data suggest these two
species are closely allied. Morphologically both are thick, fleshy lobed crusts,
with multicellular rhizoids that become
densely interwoven (tomentose), more so
in S. capensis. The upper (dorsal)
portion of mature thalli in S. capensis
and S. coriacea reveal a layer of shortcelled, erect filaments bearing the more
elongated cells of the curved filaments
of the perithallus, a condition not
observed in Peyssonnelia sensu stricto
(Fig. 1).
Specimens studied.—Isotype: Sonderopelta coriacea, #US Alg. Type Coll.13487 (distributed as ‘‘Marine Algae of
Southern Australia no. 214 [5ADA52035]’’); Pondalowie Bay, Yorke Peninsula, South Australia, 2–3 m depth, S.
M. Clarke, 14 Feb 1981. South Africa:
KwaZulu-Natal: Salmon Banks, 30 m
depth, 6 Feb 2001, S. Fredericq & O.
De Clerck #LAF-2-6-01-5 (LAF), LAF2-6-01-11 (LAF), and LAF-2-6-01-l-18
(LAF); and, Mabibi: Sodwana Reef,
16 m depth, 13 Feb 2001, S. Fredericq
& O. De Clerck #LAF-2-13-01-l-11
(LAF). Australia: Warrnambool, 13 Jul
1995, M. H. Hommersand #LAF-7-1395-1-1 (LAF).
Acknowledgments
We thank all collectors listed in Table 2, and the R/V Pelican (LUMCON)
crew for their help in collecting subtidal,
crustose algae. Our appreciation goes to
numerous colleagues who have offered
comments and discussions that have lead
to improvement of our manuscript. This
study was supported by NSF Systematic
Biology: PEET (DEB-0328491), and
Peyssonneliaceae (DEB-0919508); NSF
Biodiversity Inventories: Gulf of Mexico
(DEB-0315995, and Panama (DEB0743024); US-Panama Cooperative Research Program (OISE-0819205). This
research represents Smithsonian Marine
Station at Fort Pierce Contribution
No. SMSFP-791, and Caribbean Coral
Reef Ecosystem Program of the National
Museum of Natural History Contribution
No. CCRE-862.
Literature Cited
Abbott, I. A. 1968. Studies in some foliose red algae
of the Pacific coast, III: Dumontiaceae,
Weeksiaceae, Kallymeniaceae.—Journal of
Phycology 4:180–198.
———, & G. J. Hollenberg. 1976. Marine Algae of
California. Stanford University Press, Stanford, California, 827 pp.
Agardh, J. G. 1851. Species genera et ordines
algarum, seu descriptiones succinctae specierum, generum et ordinum, quibus algarum
regnum constituitur. Volumen secundum:
algas florideas complectens, part 2, fasc. 1.
C. W. K. Gleerup, Lundae, 167 pp.
———. 1876. Species genera et ordines algarum, seu
descriptiones succinctae specierum, generum et
ordinum, quibus algarum regnum constituitur.
Volumen tertium: de florideis curæ posteriores.
Part 1. T. O. Weigel, Lipsiae, vii + 724 pp.
Areschoug, J. E. 1854. Phyceae novae et minus
cognitae in maribus extraeuropaeis collectae
quas descriptionibus atque obscrvationibus
adumbravit John Erh. Areschoug.—Nova
Acta Regiae Societatis Scientiarum Upsaliensis, ser. 3 1:329–372.
Ballantine, D. L., & N. E. Aponte. 2005. An
annotated checklist of deep-reef benthic
marine algae from Lee Stocking Island,
Bahamas (western Atlantic), II: Rhodophyta.—Nova Hedwigia 80:147–171.
VOLUME 122, NUMBER 3
———, & H. Ruiz. 2005. Two Peyssonnelia species
(Peyssonneliaceae, Rhodophyta) from Puerto
Rico including Peyssonnelia flavescens sp.
nov.—Phycologia 44:328–334.
———, & ———. 2006. Peyssonnelia imbricata sp.
nov. (Peyssonneliaceae, Rhodophyta) from
Puerto Rico, Caribbean Sea.—Botanica Marina 49:431–437.
Boudouresque, C.-F., & M. Denizot. 1975. Révision
du genre Peyssonnelia (Rhodophyta) en
Méditerranée.—Bulletin Muséum d’Histoire
Naturelle de Marseille 35:7–92.
———, E. Coppejans, & J. Marcot. 1976. Un
nouveau genre de Peyssonneliaceae, Metapeyssonnelia
(Rhodophyta).—Phycologia
15:283–288.
Brummitt, R. K., & C. E. Powell, eds. 1992, Authors
of Plant Names. Royal Botanic Gardens,
Kew, 732 pp.
Cabioch, J. 1974. Un fond de maerl de l’Archipel de
Madère et son peuplement végétal.—Bulletin
de la Société Phycologique de France
19:74–82.
Crouan, P. L., & H. M. Crouan. 1859. Notice sur
quelques espèces et genres nouveaux d’algues
marines de la rade de Brest.—Annales des
Sciences Naturelles, Botanique, sér. 4
12:288–292.
Decaisne, J. 1841. Plantes de l’Arabie Heureuse,
recueillies par M. P.-E. Botta et décrites par
M. J. Decaisne.—Archives du Muséum d’Histoire Naturelle [Paris] 2:89–199, pls. V–VII.
———. 1842a. Essais sur une classification des
algues et des polypiers calcifères de Lamouroux.—Annales des Sciences Naturelles, Botanique, sér. 2 17:297–380, pls. 14–17.
———. 1842b. Essais sur une classification des
algues et des polypiers calcifères de Lamouroux. [2nd part.] Mémoire sur les Corallines ou
Polypiers calcifères.—Annales des Sciences
Naturelles, Botanique, sér. 2 18:96–128.
Denizot, M. 1968. Les algues Floridées encroutantes
(à l’exclusion des Corallinacées). Thesé, Laboratoire de Cryptogamie, Muséum national
d’Histoire naturelle), Paris, 310 pp.
Felsenstein, J. 1985. Confidence limits on phylogenies: an approach using the bootstrap.—
Evolution 39:783–791.
Foster, M. S., R. Riosmena-Rodrı́guez, D. L.
Steller, & W. J. Woelkerling. 1997. Living
rhodolith beds in the Gulf of California and
their implications for paleoenvironmental
interpretation. Pp. 127–139 in M. E. Johnson
and J. Ledesma-Vázquez, eds., Pliocene
Carbonates and Related Facies Flanking the
Gulf of California, Baja California, Mexico.
Special Paper 318—Geological Society of
America, Boulder, Colorado.
387
Fredericq, S., R. J. Anderson, & J. Lopez-Bautista.
2003. Circumscription of some Phyllophoraceae (Gigartinales, Rhodophyta) from the
Cape region, South Africa, based on molecular evidence. Pp. 263–274 in A. R. O.
Chapman, R. J. Anderson, V. J. Vreeland
and I. R. Davison, eds., Proceedings of the
XVIIth International Seaweed Symposium,
Cape Town, South Africa, 28 January–2
February 2001. Oxford University Press,
Oxford.
———, D. W. Freshwater, & M. H. Hommersand.
1999. Observations on the phylogenetic systematics and biogeography of the Solieriaceae
(Gigartinales, Rhodophyta) inferred from
rbcL sequences and morphological evidence.—Hydrobiologia 398/399:25–38.
———, M. H. Hommersand, & D. W. Freshwater.
1996a. The molecular systematics of some
agar- and carrageenan-containing marine red
algae based on rbcL sequence analysis.—
Hydrobiologia 326/327:125–135.
———, J. N. Norris, E. A. Zimmer, D. W.
Freshwater, & M. H. Hommersand. 1996b.
Proposal of the Dumontiales ord. nov. and
reinstatement of the Sphaerococcales Sjoestedt emend. based on family complexes
previously placed in the marine red algal
order Gigartinales.—Journal of Phycology
32(s3):16.
Freshwater, D. W., & J. C. Bailey. 1998. A
multigene phylogeny of the Gelidiales including nuclear large-subunit rRNA sequence
data.—Journal
of
Applied
Phycology
10:229–236.
———, S. Fredericq, & J. C. Bailey. 1999.
Characteristics and utility of nuclear-encoded
large-subunit ribosomal gene sequences in
phylogenetic studies of red algae.—Phycological Research 47:33–38.
———, ———, B. S. Butler, M. H. Hommersand,
& M. W. Chase. 1994. A gene phylogeny of
the red algae (Rhodophyta) based on plastid
rbcL.—Proceedings of the National Academy
of Sciences of the United States of America
91:7281–7285.
Gavio, B., & S. Fredericq. 2002. Grateloupia
turuturu (Halymeniaceae, Rhodophyta) is
the correct name of the non-native species in
the Atlantic known as Grateloupia doryphora.—European Journal of Phycology
37:349–359.
———, E. L. Hickerson, & S. Fredericq. 2005.
Platoma chrysymenioides sp. nov. (Schizymeniaceae), and Sebdenia integra sp. nov.
(Sebdeniaceae), two new red algal species
from the northwestern Gulf of Mexico, with a
phylogenetic assessment of the Cryptonemiales complex (Rhodophyta).—Dedicated
388
PROCEEDINGS OF THE BIOLOGICAL SOCIETY OF WASHINGTON
Issue, Flower Garden Banks National Marine
Sanctuary,
Gulf
of
Mexico
Science
25(1):38–57.
Gmelin, S. G. 1768. Historia Fvcorvm. Ex typographia Academiae scientiarum, Petropoli [St.
Petersburg], [xii] + 239 + 6 pp., 35 pls. [1A, IB,
IIA, IIB, III–XXXIII].
Guimarães, S. M. P. B., & M. T. Fujii. 1999.
Morphological studies of five species of
Peyssonnelia (Gigartinales, Rhodophyta)
from southeastern Brazil.—Phycologia 38:
167–183.
Guindon, S., & O. Gascuel. 2003. A simple, fast, and
accurate algorithm to estimate large phylogenies by maximum likelihood.—Systematic
Biology 52:696–704.
Harper, J. T., & G. W. Saunders. 2001. Molecular
systematics of the Florideophyceae (Rhodophyta) using nuclear large and small subunit
rDNA sequence data.—Journal of Phycology
37:1073–1082.
———, & ———. 2002a. A re-classification of the
Acrochaetiales based on molecular and morphological data, and establishment of the
Colaconematales ord. nov. (Florideophyceae,
Rhodophyta).—European Journal of Phycology 37:463–476.
———, & ———. 2002b. Using molecular data to
resolve the taxonomic limits of the genera
Callophyllis, Euthora and Pugetia (Kallymeniaceae, Rhodophyta).—Phycological Research 50:275–281.
Hauck, F. 1885. Die Meeresalgen Deutschlands und
Oesterreichs. In Dr. L. Rabenhorst’s Kryptogamen-Flora von Deutschland, Oesterreich
und der Schweiz. Vol. 2. Zweite Auflage.
Verlag von Eduard Kummer, Leipzig, xxiv +
575 [576] pp.
Heydrich, F. 1905. Polystrata, eine Squamariacee
aus den Tropen.—Berichte der Deutschen
Botanischen Gesellschaft 23:30–36.
Hollenberg, G. J. 1970. Phycological notes. IV.
Including new marine algae and new records
for California.—Phycologia 9:61–72.
Holmgren, P. K., N. H. Holmgren, & L. C. Barnett.
1990. Index Herbariorum. Pt. 1: The Herbaria of the World. 8th Edition. New York
Botanical Garden, New York, x + 693 pp.
Hommersand, M. H., & S. Fredericq. 1990. Sexual
reproduction and cystocarp development.
Pp. 305–345 in K. M. Cole and R. G. Sheath,
eds., Biology of the Red Algae. Cambridge
University Press, New York, 517 pp.
———, ———, & D. W. Freshwater. 1994.
Phylogenetic systematics and biogeography
of the Gigartinaceae (Gigartinales, Rhodophyta) based on sequence analysis of rbcL.—
Botanica Marina 37:193–203.
Huelsenbeck, J. P., & F. Ronquist. 2001.
MRBAYES: Bayesian inference of phylogeny.—Bioinformatics 17:754–755.
Itono, H., & M. Yoshizaki. 1992a. Female reproductive morphology and taxonomy of Rhodopeltis Harvey (Polyidaceae, Rhodophyta).
I. R. australis Harvey and R. borealis
Yamada.—Reports of the Faculty of Science,
Kagoshima University (Earth Science &
Biology) 25:125–135.
———, & ———. 1992b. Female reproductive
morphology and taxonomy of Rhodopeltis
Harvey (Polyidaceae, Rhodophyta). II. R.
gracilis Yamada et Tanaka, R. liagoroides
Yamada and R. setchelliae Yamada.—Reports of the Faculty of Science, Kagoshima
University (Earth Science & Biology)
25:137–147.
James, N. P., J. L. Wray, & R. N. Ginsburg. 1988.
Calcification of encrusting aragonitic algae
(Peyssonneliaceae); implications for the origin
of late Paleozoic reefs and cements.—Journal
of Sedimentary Research 58:291–303.
Johnson, J. H. 1964. Paleocene calcareous red algae
from northern Iraq.—Micropaleontology
10:207–216.
Kato, A., & M. Masuda. 2002. A morphological
study of Peyssonnelia meridionalis (Gigartinales, Rhodophyta), with discussion of spermatangial types within the genus.—Phycologia 41:191–198.
———, & ———. 2003. A new crustose red alga
Peyssonnelia rumoiana (Rhodophyta, Gigartinales) from Japan.—Phycological Research
51:21–28.
Kraft, G. T., & P. Robins. 1985. Is the order
Cryptonemiales (Rhodophyta) defensible?—
Phycologia 24:67–77.
Kuntze, [C. E.] O. 1891. Revisio generum plantarum vascularium omnium atque cellularium multarum secundum leges nomenclaturae internationales cum enumeratione
plantarum exoticarum in itinere mundi
collectarum. Part 2. Pp. 377–1011. Arthur
Felix, Leipzig [etc.].
Kützing, F. T. 1847. Diagnosen einiger neuen
ausländischen Algenspecies, welche sich in
der Sammlung des Herrn Kammerdirectors
Klenze
in
Laubach
befinden.—Flora
30:773–776.
———. 1859. Tabulae phycologicae; oder, Abbildungen der Tange. Vol. 9. Kosten des Verfassers (In Commission bei Ludwig Klincksieck), Nordhausen, viii + 42 pp., 100 pls.
Kylin, H. 1930. Über die Entwicklungsgeschichte
der Florideen.—Lunds Universitets Årsskrift,
Ny Följd, Andra Afdelningen 26(6):1–103
+ [1].
VOLUME 122, NUMBER 3
———. 1932. Die Florideenordnung Gigartinales.—
Lunds Universitets Årsskrift, Ny Följd, Andra Afdelningen 28(8):1–88, 22 figs., 28 pls.
———. 1956. Die Gattungen der Rhodophyceen. C.
W. K. Gleerup, Lund, xv + 673 pp.
Le Gall, L., & G. W. Saunders. 2007. A nuclear
phylogeny of the Florideophyceae (Rhodophyta) inferred from combined EF2, small
subunit and large subunit ribosomal DNA:
establishing the new red algal subclass Corallinophycidae.—Molecular
Phylogenetics
and Evolution 43:1118–1130.
Leliaert, F., & E. Coppejans. 2004. Crystalline cell
inclusions: a new diagnostic character in the
Cladophorophyceae (Chlorophyta).—Phycologia 43:189–203.
Lewis, J. A., & G. T. Kraft. 1992. Zymurgia, a new
genus in the Halymeniaceae (Gigartinales,
Rhodophyta) from southeastern Australia.—
Phycologia 31:285–299.
Lin, S.-M., S. Fredericq, & M. H. Hommersand.
2001. Systematics of the Delesseriaceae (Ceramiales, Rhodophyta) based on large subunit
rDNA and rbcL sequences, including the
Phycodryoideae, subfam. nov.—Journal of
Phycology 37:881–899.
Littler, M. M., D. S. Littler, S. M. Blair, & J. N.
Norris. 1985. Deepest known plant life
discovered on an uncharted seamount.—
Science 227:57–59.
———, ———, ———, & ———. 1986. Deepwater plant communities from an uncharted
seamount off San Salvador Island, Bahamas:
distribution, abundance, and primary productivity.—Deep-Sea Research 33:881–892.
Ludwig, C. G. 1757. Institutiones historico-physicae
regni vegetabilis in usum auditorium adornatae a D. Christano Gottlieb Ludwig …
vegetabilis praelectionibus academicis accomodatae. Editio altera aucta et emendate. [2nd
Edition] Joh. Fridericum Gleditschium, Leipzig, [xiv] + 264 + [10] pp.
Maddison, D. R., & W. P. Maddison. 2000.
MacClade 4: Analysis of phylogeny and
character evolution. Sinauer Associates, Sunderland, Massachusetts,
Maggs, C. A. 1990. Distribution and evolution of
non-coralline crustose red algae in the North
Atlantic. Pp. 241–264 in D. J. Garbary and
G. R. South, eds., Evolutionary Biogeography of the Marine Algae of the North
Atlantic (NATO ASI Series, Sub-Series G,
Ecological Sciences). Springer-Verlag, Berlin,
429 pp.
McNeill, J., et al. (2006). International Code of
Botanical Nomenclature (Vienna Code). Regnum Vegetabile, vol. 146. A. R. G. Gantner
Verlag, Ruggell, Lichenstein, xviii + 568 pp.
389
Moe, R. L. 1985. Gainia and Gainiaceae, a new
genus and family of crustose marine Rhodophyceae
from
Antarctica.—Phycologia
24:419–428.
Montagne, C. 1847. Enumeratio fungorum quos a
cl. Drège in Africa meridionali collectos et in
herbario Miqueliano servatos descriptionibus
nonnullis illustravit.—Annales des Sciences
Naturelles, Botanique, sér. 3, 7:166–181.
Nelson, W. A., & N. M. Adams. 1993. Nesophila
hoggardii gen. et sp. nov. (Rhizophyllidaceae,
Rhodophyta) from offshore islands of northern New Zealand.—Museum of New Zealand
Records 1:1–7. [Tuhinga: Records of the
Museum of New Zealand Te Papa Tongarewa 5:1–8 (1996)]
Norris, R. E. 1957. Morphological studies on the
Kallymeniaceae.—University of California
Publications in Botany, Berkeley 28:251–334.
Nozawa, Y. 1970. Systematic anatomy of the red
algal genus Rhodopeltis.—Pacific Science
24:99–133.
N’Yeurt, A. D. R., C. E. Payri, P. W. Gabrielson, &
S. Fredericq. 2006. Pinnatiphycus menouana
gen. et sp. nov. (Rhodophyta: Dicranemataceae) from New Caledonia and Fiji (South
Pacific): vegetative and reproductive morphology and molecular phylogeny.—Phycologia 45:422–431.
Papenfuss, G. F. 1966. A review of the present
system of classification of the Florideophycidae.—Phycologia 5:247–255.
Posada, D., & K. A. Crandall. 1998. MODELTEST: testing the model of DNA substitution.—Bioinformatics 14:817–818.
Pueschel, C. M. 1989. An expanded survey of the
ultrastructure of red algal pit plugs.—Journal
of Phycology 25:625–636.
Rao, C. S. P. 1956. The life-history and reproduction of Polyides caprinus (Gunn.) Papenf.—
Annals of Botany 20:211–230.
Rasser, M. W., & B. Riegl. 2002. Holocene coral
reef rubble and its binding agents.—Coral
Reefs 21:57–72.
Saunders, G. W., & M. H. Hommersand. 2004.
Assessing red algal supraordinal diversity and
taxonomy in the context of contemporary
systematic data.—American Journal of Botany 91:1494–1507.
———, & G. T. Kraft. 1994. Small-subunit rRNA
gene sequences from representatives of selected families of the Gigartinales and Rhodymeniales (Rhodophyta). 1. Evidence for the
Plocamiales ord.nov.—Canadian Journal of
Botany 72:1250–1263.
———, & ———. 1996. Small-subunit rRNA gene
sequences from representatives of selected
families of the Gigartinales and Rhodyme-
390
PROCEEDINGS OF THE BIOLOGICAL SOCIETY OF WASHINGTON
niales (Rhodophyta). 2. Recognition of the
Halymeniales ord.nov.—Canadian Journal of
Botany 74:694–707.
———, A. Chiovitti, & G. T. Kraft. 2004. Smallsubunit rDNA sequences from representatives of selected families of the Gigartinales
and Rhodymneniales (Rhodophyta). 3. Delineating the Gigartinales sensu stricto.—
Canadian Journal of Botany 82:43–74.
Schmitz, F. 1883. Untersuchungen über die Befruchtung der Florideen.—Sitzungsberichten
der Königlichen Akademie der Wissenschaften zu Berlin 1883(1):215–258, pl. 5.
———. 1892. (6. Klasse Rhodophyceae.) 2. Unterklasse Florideae. Pp. 16–23 in A. Engler,
ed., Syllabus der Vorlesungen über specielle
und medicinisch-pharmaceutische Botanik.
Grosse Ausgabe [Edition 1]. Gebr. Borntraeger, Berlin, 184 pp.
Schneider, C. W., & R. P. Reading. 1987. A revision
of the genus Peyssonnelia (Rhodophyta,
Cryptonemiales) from North Carolina, including P. atlantica new species.—Bulletin of
Marine Science 40:175–192.
———, & M. J. Wynne. 2007. A synoptic review of the
classification of red algal genera a half century
after Kylin’s ‘‘Die Gattungen der Rhodophyceen.’’—Botanica Marina 50:197–249.
Searles, R. B. 1968. Morphological studies of red
algae of the order Gigartinales.—University
of California Publications in Botany 43:1–86.
Sherwood, A. R., & R. G. Sheath. 2003. Systematics
of the Hildenbrandiales (Rhodophyta): gene
sequence and morphometric analyses of
global collections.—Journal of Phycology
39:409–422.
———, T. B. Shea, & R. G. Sheath. 2002. European
freshwater Hildenbrandia (Hildenbrandiales,
Rhodophyta) have not been derived through
multiple invasions from marine habitats.—
Phycologia 41:87–95.
Silva, P. C. 1952. A review of nomenclatural
conservation in the algae from the point of
view of the type method.—University of
California Publications in Botany 25:241–323.
———. 1980. Names of classes and families of living
algae, with special reference to their use in the
Index Nominum Genericorum (Plantarum).
Regnum vegetabile, vol. 103. Bohn, Scheltema, & Holkema, Utrecht, [iii] + 156 pp.
———, & H. W. Johansen. 1986. A reappraisal of
the order Corallinales (Rhodophyceae).—
European Journal of Phycology 21(3):245–
254.
———, E. G. Meñez, & R. L. Moe. 1987. Catalog
of the benthic marine algae of the Philippines.
Smithsonian Contributions to the Marine
Sciences; no. 27. Smithsonian Institution
Press, Washington, D.C, iv + 179 pp.
Sjöstedt, L. G. 1926. Floridean studies.—Lunds
Universitets Årsskrift, ny följd 2 22(4):1–94.
Sonder, O. G. 1853. Plantae Muellerianae. Algae.—
Linnaea 25:657–703.
Stockar, R. 2001. Polystrata alba (Pfender) Denizot
and Peyssonnelia antiqua Johnson: two peyssonneliacean algae (Rhodophyta) from the
Paleocene of the Tabiago Formation (Montorfano Member Section type-section, Como,
Northern Italy).—Geologia Insubrica 6:15–
22.
Swofford, D. L. 2003. PAUP*: Phylogenetic Analysis Using Parsimony (*and other methods).
Version 4.0. Sinauer Associates, Sunderland,
Massachusetts.
Taylor, W. R. 1960. Marine Algae of the Eastern
Tropical and Subtropical Coasts of the
Americas. University of Michigan Press,
Ann Arbor, Michigan, xi + 870 pp.
Thompson, J. D., T. J. Gibson, F. Plewniak, F.
Jeanmougin, & D. G. Higgins. 1997. The
CLUSTAL_X windows interface: flexible
strategies for multiple sequence alignment
aided by quality analysis tools.—Nucleic
Acids Research 25(24):4876–4882.
Tsuda, R. T., & I. A. Abbott. 1985. Collection,
handling, preservation, and logistics. Pp. 67–86
in M. M. Littler and D. S. Littler, eds.,
Handbook of Phycological Methods: Volume
4: Ecological Field Methods: Macroalgae.
Cambridge University Press, New York.
Valentin, K., & K. Zetsche. 1989. The genes of
both subunits of ribulose-1,5-bisphosphate
carboxylase constitute an operon on the
plastome of a red alga.—Current Genetics
16(3):203–209.
Vis, M. L., G. W. Saunders, R. G. Sheath, K.
Dunse, & T. J. Entwisle. 1998. Phylogeny of
the Batrachospermales (Rhodophyta) inferred from rbcL and 18S ribosomal RNA
gene sequences.—Journal of Phycology
34(2):341–350.
Weber-van Bosse, A. 1921. Liste des algues du Siboga.
II. Rhodophyceae. Premère partie. Protofloridae, Nemalionales, Cryptonemiales.—SibogaExpeditie Monographie 59b:187–310, figs. 53–
109, pls. VI–VII. Leiden.
Wiseman, D. R. 1975. On the status of the red algal
family, the Rhizophyllidaceae (Gigartinales).—Taxon 24:489–490.
———. 1977. Observations on the reproductive
morphology of the red algal genus Ochtodes J.
Agardh (Rhizophyllidaceae, Gigartinales).—
Phycologia 16:1–8.
Womersley, H. B. S. 1994. The Marine Benthic
Flora of Southern Australia. Rhodophyta.
Part IIIA. Bangiophyceae and Florideophyceae (Acrochaetiales to Gigartinales). Flora
VOLUME 122, NUMBER 3
of Australia Supplementary Series Number 1.
Australian Biological Resources Study, Canberra, 508 pp.
———, & D. Sinkora. 1981. Sonderophycus and the
type specimen of Peyssonnelia australis (Cryptonemiales, Rhodophyta).—Transactions of
the Royal Society of South Australia
105(2):85–87.
Yoneshigue, Y. 1985. Taxonomie et Ecologie des
Algues Marines dans la Région de Cabo Frio
(Rio de Janeiro, Brésil). Thèse de Docteur
d’Etat-Sciences, Faculté des Sciences de
Luminy, à l’Université d’Aix-Marseille II,
466 pp.
Yoon, H. S., K. M. Müller, R. G. Sheath, F. D. Ott,
& D. Bhattacharya. 2006. Defining the major
lineages of red algae (Rhodophyta).—Journal
of Phycology 42(2):482–492.
Zanardini, G. [A. M.]. 1841. Synopsis Algarum in
mari Adriatico hucusque collectarum, cui
391
accedunt Monographia Siphonearum nec
non generales de Algarum vita et structura
disquisitiones cum tabulis auctoris manu ad
vivum depictis.—Memorie della Reale Accademia delle Scienze di Torino, Ser. 2, Tome
4:105–255, pls. I–VIII. [also reprinted: with
same title & date, 153 pp., pls. 1–8. Taurini
[Torino]: Regio Typographeo.]
———. 1858. Plantarum in mari Rubro hucusque collectarum enumeriato (juvante A.
Figari).—Memorie del Reale Istituto Veneto
di Scienze, Lettere ed Arti 7(2):209–309, pls.
III–XIV.
Zhang, D., & J. Zhou. 1981. Ramicrusta, a new
genus of Peyssonneliaceae (Cryptonemiales,
Rhodophyta).—Oceanologia et Limnologia
Sinica 12(6):538–544.
Associate Editor: Carol Hotton.