Zootaxa 4952 (3): 540–550 https://www.mapress.com/j/zt/ Copyright © 2021 Magnolia Press ISSN 1175-5326 (print edition) Article ZOOTAXA ISSN 1175-5334 (online edition) https://doi.org/10.11646/zootaxa.4952.3.6 http://zoobank.org/urn:lsid:zoobank.org:pub:05088388-AAFF-464A-99D2-3AB61B6AA966 A new species of palaemonid prawn Macrobrachium ramae sp.nov. (Malacostraca: Decapoda:Palaemonidae) from Rupnarayana River, West Bengal, India with its molecular profiles MITALI DAS1*, PRITI RANJAN PAHARI1,3 & TANMAY BHATTACHARYA2 1 Department of Zoology,Tamralipta Mahavidyalaya,Tamluk,Purba Medinipur 721636,West Bengal,India. Professor (Retired), Department of Zoology,Vidyasagar University,Midnapore 721102, West Bengal,India. � prof.t.bhattacharya@gmail.com; https://orcid.org/0000-0001-7359-2789 3� priti.pahari@rediffmail.com; https:orcid.org/0000-0002-5331-0091 * Corresponding author. � kgpmitalidas@gmail.com; http://orcid.org/0000-0002-4326-7878 2 Abstract A new species Macrobrachium ramae is described from Rupnarayana river, West Bengal, India along with its molecular characterization and Scanning electron microscopy. The species shares certain characters with M.gurudeve, M.jayasreei, M.kunjuramani and M.saengphani but differs remarkably from these species in the structure and shape of rostrum, telson, appendix masculina and in the size of the proximal segment of the antennular peduncle. Molecular characterization and phylogenetic analysis of M.ramae with mitochondrial COI and 16S rRNA genes reinforce the morphological conclusion and supports the view that it is a new species. Key words: Macrobrachium ramae sp. nov., Palaemonidae ,COI, 16S rRNA, Rupnarayana River, India Introduction According to De Grave & Fransen (2011) genus Macrobrachium Bate,1868 has 244 recognized species distributed mainly in tropical and subtropical waters around the world.Several new species have been described subsequently by Xuan (2012), Pillai et al.(2014), Cai & Vidthayanon (2016), Saengphan et al. (2018, 2020), Xiao-Zhuang Zheng et al. (2019), Rossi et al.(2020). According to Radhakrishnan et al. (2012) genus Macrobrachium is represented in India by 62 species. Subsequently 4 new species viz., M.prabhakarani Pillai & Unnikrishnan, 2012, M. snpurii Pillai & Unnikrishnan, 2013a, M. abrahami Pillai et al.2014, M.indianum Pillai et al. 2015 and one subspecies M. aemulum keralauni Pillai & Unnikrishnan 2013b have been described. Hence the total number of species reported from India, till date is 66. Taxonomy of the genus Macrobrachium is mainly based on morphological characters such as relative length of the podomeres of the second pereiopods in fully developed males, rostrum shape, dentiton and colouration (Holthuis 1950a, Chace and Bruce 1993). Some of these morphological characteristics have been proven highly variable within the species e.g., rostrum shape and colouration .The second chelipeds show very high level of developmental and sexual variation, including allometric growth in males (Short 2004), making it a challenge to identify and distinguish different species and almost impossible to identify juvenile, immature and adult female specimens. During a survey along the coastal region of West Bengal, India, several species of prawns were collected from the lower reaches of Rupnarayana river (Pahari et al.2020). 23 specimens showed morphometric and meristic characters that did not conform to any other known species of Macrobrachium. Thus, as advocated by earlier researchers (Liu et al. 2007, Jose and Harikrishnan 2019), comprehensive molecular characterizations have become a crucial step towards resolving the taxonomic ambiguities of these specimens, to find out to which species these belong to and whether the result from morphological analysis done in this study is concordant with molecular findings. Molecular characterizations of the specimens were done using mitochondrial COI which is a universal DNA barcode gene for animals along with mitochondrial 16S rRNA gene. 540 Accepted by J. Goy: 3 Mar. 2021; published: 12 Apr. 2021 Materials and methods Sample collection Collections from the lower reaches of the Rupnarayana river at Charsankarara, Tamluk (87º55’17.0004’’e, 22º17’25.0008’’N) by one of the authors (PRP) on 21st September 2019 contained 13 males, 3 ovigerous and 7 non ovigerous females exhibiting certain distinctive characters which are considered as new species. Specimens were preserved in 75% alcohol for DNA extraction and stored at -20°C until the test commenced .The holotype (Fig.1A), allotype (Fig.1B) and 3 paratypes (Reg.no. ZSI/FPS/C8643/2 – ZSI/FPS/C8645/2 ) have been deposited in the faunal depository of the Zoological Survey of India, Kolkata,West Bengal, India. Morphological method Species identification and validation have been carried out using standard keys and literature of Kemp (1917), Holthuis (1950 a & b), Jayachandran (2001), Jayachandran & Raji (2004). Scanning electron Microscopy was carried out by Zeiss Supra- 40 to determine structure of chela, setae pattern of appendix musculina, mandibular palp segments to distinguish from closely related species.The test samples were coated with a thin gold palladium layer using sputter coater polaron SC515 to prevent electric charge accumulation during examination.The SeM micrographs were obtained under conventional secondary electron imaging conditions with an accelerating voltage of 5 kV. Molecular method DNA extraction Total genomic DNA was extracted from 25 mg of alcohol preserved muscle tissue samples. 06 samples were used for DNA extraction using phenol-chloroform method as described by Sambrook et al. (1989) with few modifications following Mandal et al.(2014). Quality of the extracted DNA was analyzed using 0.7% agarose gel and quantity of the genomic DNA was assessed by Optical Density (OD) at 260nm using Biophotometer (eppendorf). The extracted DNA samples were stored at -20°C for further study. Polymerase Chain Reaction for COI and 16S rRNA gene The cytochrome c-oxidase subunit I gene (COI) was amplified from 06 samples using universal primers LCO1490 (5’-GGTCAACAAATCATAAAGATATTGG-3’) and HCO2198 (5’-TAA ACTTCAGGGTGACCAAAAAATCA3’) as described by Folmer et al. (1994). PCR was performed in a final volume of 25 µl containing 0.2 mM dNTPs, 1.5mM MgCl2, 1X PCR buffer, 0.2 µM of each primer, 75 ng genomic DNA, and 1.0 U Taq DNA polymerase. The amplification was carried at initial denaturation 94°C for 3 min, denaturation at 94°C for 1 min, annealing at 45°C for 1 min, extension at 72°C for 1 min for 35 cycles and the final extension step was at 72°C for 10 min. 16S rRNA gene was amplified using the pair of Universal Forward (5’-CGCCTGTTTAACAAAAACAT-3’) and Reverse (5’CCGGTCTGAACTCAG A TCATGT-3’) primers (Shekhar et al. 2005). Six samples were selected and the amplification was performed in 25µl reaction volume containing 1X standard buffer, 1.5mM MgCl2, 0.2mM dNTP, 0.2µM each primer, 50ng of genomic DNA and 0.5unit Taq polymerase. PCR reactions were started after the initial denaturation at 94ºC for 1 min. 30 PCR cycles were carried out for denaturation at 93°C for 1 min, annealing at 50ºC for 30sec, extension at 72°C for 1 min. and final extension at 72°C for 7 min. The PCR Amplicon was visualized under UV light in 2% agarose gel stained with ethidium bromide. Amplified products were purified using a gel purification kit (GeneJeT PCR purification kit; Thermo Scientific). Sequencing and data analysis Sequencing of amplified products was performed for forward and reverse directions in Applied Biosystems 3500 Genetic Analyzer using BigDye Terminator V3.1 cycle sequencing kit. The phylogenetic tree was constructed using neighbor-joining method under the assumption of Kimura-2-Patameters with 1000 replicates using MeGA version 6 (Tamura et al. 2013). Mangrove mud crab sequences (Scylla serrata; KC200562 and AB857343) were used as an outgroup for phylogenetic relationship analysis using COI and 16S rRNA gene. A NeW SPeCIeS OF PALAeMONID PRAWN Zootaxa 4952 (3) © 2021 Magnolia Press · 541 Molecular phylogeny DNA fragments of 709 bp and 562 bp were amplified using mitochondrial COI and 16S rRNA genes respectively. The sequences generated from the current study were published in NCBI GenBank with the accession number provided in Table 1. The sequences were subjected for similarity searching using NCBI BLAST to find out the close relatives and taxonomic position of the species. The BLAST search of COI gene sequences shows 99% identity with Macrobrachium lamarrei and the 16S rRNA gene sequences shows 99% identity with Macrobrachium rude. TABle 1. Details of the samples used with accession number Name of the species GenBank accession number COI gene Macrobrachium ramae-Hap-1 MW421978 Macrobrachium ramae-Hap-2 MW421979 Macrobrachium ramae-Hap-3 MW421980 Macrobrachium ramae-Hap-4 MW421981 06 samples were sequenced for COI gene (3 males and 3 females) and four haplotypes were found. 16s rRNA gene Macrobrachium ramae-Hap-1 MW414676 Macrobrachium ramae-Hap-2 MW414677 Macrobrachium ramae-Hap-3 MW414678 Macrobrachium ramae-Hap-4 MW414679 Macrobrachium ramae-Hap-5 MW414680 06 samples were sequenced for 16s rRNA gene (3 males and 3 females) and five haplotypes were found. The neighbor-joining tree using COI gene (Fig. 4)shows that the 04 haplotypes of Macrobrachium ramae sp.nov. were clustered together with Macrobrachium lamarrei and the 05 haplotypes of M. ramae sp.nov. generated through 16S rRNA(Fig. 5) gene was clustered together with Macrobrachium rude. Taxonomic account Genus Macrobrachium Bate, 1868 Macrobrachium ramae sp. nov. (Fig. 1–3) Materials examined. Measurements (in mm), HOLOTYPe (1♂, Fig.1A): total length 44.0, carapace length 10.0, rostrum length 9.0, telson length 9.0. First pereiopod : ischium (i) = 2.6, merus (m) = 4.8, carpus (c)= 5.0, propodus (p) = 3.0, dactylus (d) = 1.5 . Second pereiopod : i = 5, m = 5.8, c = 8.0, p = 9.0, d = 5.0. Third pereiopod : i = 3.5, m = 6.0, c = 3.0, p = 5.5, d = 2.0. Fourth pereiopod : i = 4.0, m = 6.2, c = 3.8, p = 7.5, d = 2.0. Fifth pereiopod : i = 4.0, m = 6.5, c = 4.0, p = 7.8, d = 2.8. ALLOTYPE (1♀Fig.1B): total length 64.0, carapace length 16.0 ,rostrum length 12.0, telson length 10.0. First pereiopod: ischium (i) 4.0 , merus (m) 7.0,carpus (c) 9.0, propodus (p) 4.5. dactylus (d) 2.5. Second pereiopod : i = 8.0, m = 9.0, c = 12.5, p = 13.5, d = 7.0. Third pereiopod: i = 3.8, m = 9.0, c = 3.8, p = 6.8, d = 2.5. Fourth pereiopod: i = 4.0, m = 9.0, c = 4.5, p = 8.5, d = 2.8. Fifth pereiopod : i = 4.0, m = 9.5, c = 4.8, p = 10.0, d = 3.0. PARATYPES: (based on 4 ♂ ) Total length 38–44, carapace length 9–10, rostrum length 8–14,telson length 6–9.5. First pereiopod: ischium (i) 2.0 –2.5; merus (m) 4.0–4.8, carpus (c) 6,0–7.5, propodus (p) 2.5–3.0; dactylus (d) 1.0–1.5. 542 · Zootaxa 4952 (3) © 2021 Magnolia Press DAS eT AL. Second pereiopod: i = 4.5–5.0, m = 4.8–5.8, c = 7.2–8.0, p = 8.5–9.2, d = 4.75–5.0. Third pereiopod : i = 2.8–3.0, m = 5.5–6.0, c = 2.2–2.5, p = 4.5–5.5, d = 1.8–2.0. Fourth pereiopod : i = 3.0–3.5, m =5.0– 6.0, c = 2.5–3.0, p = 6.2–7.0, d = 1.5– 2.0. Fifth pereiopod : i = 3.5–3.8, m = 6.2–6.8, c = 3.75–4.5, p = 7.0–7.8, d = 2.0–2.8. (Based on 4 ♀) Total length 59.0–69.5, carapace length 16.0–18.0, rostrum length 11.5–14.0,telson length 8.5–10.0. First pereiopod : ischium (i) 4.5–4.8, merus (m) 6.8–7.0, carpus (c) 8.5–10.0, propodus (p) 4.25–5.0, dactylus (d)1.5–2.75. Second pereiopod : i = 6.75–8.0, m = 9.0–9.5, c = 12.0–14.0, p = 15.5–17.0, d = 7.5–8.2. Third pereiopod : i = 3.8–4.2, m = 8.0–10.0, c = 3.5–4.5, p = 7.0–8.0, d = 2.5–3.0. Fourth pereiopod: i = 4.0–4.5, m =9.0– 9.25, c = 4.0–4.5, p = 8.0–8.5, d = 2.5–3.0. Fifth pereiopod: i = 3.8–4.5, m = 9.0–10.0, c = 4.5–5.8, p = 9.5–10.0, d = 3.0–3.5. Description. Rostrum broad, overreaching antennal scale, tip directed slightly upwards. Rostral formula 9– 12/3–5 with 2 postorbitals; wide gap between 1st and 2nd post orbital tooth, 1st post orbital and rest of the dorsals closely packed; 1st ventral is located at half length of rostrum and last one at the level of 9/10 dorsal tooth. Carapace smooth, 6–8 mm in males, 17–19 mm in females; both antennal and hepatic spine present, latter situated below and behind the former (Fig.1C). FIGuRe 1. Macrobrachium ramae.sp.nov. A. Male (right lateral view); B. Female (right lateral view); C.Carapace (right lateral View) ; D.1st pereiopod; e.Chela of male; F. 2nd pereiopod of female; G.H.I.1st ,2nd ,and 3rd Pleopod; J.Telson A NeW SPeCIeS OF PALAeMONID PRAWN Zootaxa 4952 (3) © 2021 Magnolia Press · 543 Abdomen glabrous, pleurae of somites I–III typical, IV and V directed backwards, VI ending in spine. Telson broad, stout. conical with a median projection and two pairs of dorsal spines and two pairs of distal spines ;1st dorsal pair situated at 45–50%, 2nd pair at 66–70% distance; inner pair of distal spines very long, overreaching tip of telson ;3 pairs of plumose setae present between inner pair of spines. eyes and cornea well developed, broader than eye stalk, slightly pigmented. Length of three segments of antennular peduncle, 5.5(proximal): 2(middle): 3(distal); lateral spine of basal segment not reaching middle segment. Tip of antennal scale round, outer spine subdistal, length 3 times as long as breadth. Mandible three segmented, middle segment shortest,apical one longest with one apical and one subapical row of setae (Fig.3F). Maxillula, maxilla,1st maxilliped , 2nd maxilliped typical of Macrobrachium. 3rd maxilliped overreaching antennular peduncle, reaching nearly basal 1/3rd of carpus of 1st pereiopod.(Fig.2.a ,b,c,d,e) 1st pereiopod slender; chela overreaching antennal scale; ischium slightly shorter than propodus,0.61 to 0.66 times as long as merus,0.50 to 0.57 times as long as carpus; dactylus and palm equal (Fig.1D). 2nd pereiopods exhibit sexual dimorphism. Male chelipeds equal,0.5 to 0.62 times of total body length; carpus longer than merus, ischum, shorter than propodus, podomere longest; dactylus equal or slightly longer than ischium; fingers distinctly longer than inflated palm with sharp ridge along the cutting edge (Fig.1e,2Ai,2D). Ratio (in %) of ischium, merus, carpus, propodus, dactylus, palm are 18(i):20.9(m):28.8(c):32.3(p):18(d):14.3(palm). Female chelipeds subequal, 0.59 to 0.63 times of body length (Fig.1F); carpus stout, conical near palm, longer than merus and ischium, shorter than propodus, podomere largest; dactylus equal to merus,0.50 to 0.62 times as long as propodus; palm inflated, equal to or longer than slender fingers,1 minute and 2 blunt denticles at the base of immovable finger and movable finger respectively. Ratio ( in %) of ischium, merus, carpus, propodus, dactylus, palm are 16.0(i):22.5(m):29.7(c): [32.1(p)]:16.0(d): 15.4(palm). 3rd to 5th pereiopods simple, 5th one longest. 1st pleopod typical of Macrobrachium (Fig.1G). 2nd pleopod in male with appendix masculina bearing 1 short , 2 long stiff distal setae and two lateral rows of 12-14 spinous setae (Fig.2C,2B), 2nd pleopod in female simple.3rd to 5th pleopod simple in both the sexes (Fig.1I). Colouration. Body transluscent ; Carapace, rostrum, antennal scale, antennular peduncle, first three abdominal pleurae without pigmentation, ventrolateral margin of 4th ,5th, 6th abdominal pleurae and uropod with dark brown pigmentation; 2nd chelate leg has reddish brown pigmentation in entire carpus,outer margin of palm and fingers, half of merus close to carpus; red pigmentation in antennular flagella and at distal end of propodus; podomere joints of 3rd,4th & 5th pereiopods with yellow bands.(Fig.2e). Discussion. A comparison of morphological characters (Table .2) shows that M. ramae sp. nov. shares several characters with M. gurudeve, M. jayasreei, M. kunjuramani and M. saengphani. However the new species can easily be distinguished from these species by the structure of rostrum, telson, appendix masculina and in presence of bigger proximal antennular peduncle segment as compared to middle and distal segments.A key is given below for distinctive identification of the five species. Identification key: 1. 2. 3. 4. - Carapace shorter than rostrum . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 2 Carapace longer than rostrum . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 3 Uropodal exopod with accessory spine; telson slender . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 4 Uropodal exopod without accessory spine;telson broad . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .M.gurudeve Uropodal exopod without accessory spine; telson slender . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .M.jayasreei Uropodal exopod with accessory spine; telson broad . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .M.ramae sp.nov. Antennal spine with carina,males longer than females . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . M.kunjuramani Antennal spine without carina,males smaller than females . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .M.saengphani 544 · Zootaxa 4952 (3) © 2021 Magnolia Press DAS eT AL. FIGuRe 2. Mouth parts of Macrobrachium ramae.sp.nov.A.Maxillula; B.Maxilla; C.1st maxilliped; D.2nd maxilliped; e.3rd maxilliped. Different haplotypes of M. ramae sp. nov. generated using both COI and 16S rRNA gene sequences of 3 males and 3 females cluster together in molecular phylogenetic trees, strongly suggests that the specimens belong to same species. Neither 16s rRNA nor COI gene sequences of M. gurudeve, M. jayasreei, M. kunjuramani are available in NCBI, except COI gene sequence of M. Saengphani, which forms a very distant clade from M. ramae sp. nov. (Fig. 4). Neighbor-joining tree of COI gene sequences of different Macrobrachium species shows that, M. ramae sp. nov. forms cluster with M. lamarrei and M. rude remains as separate clade. However, Neighbor-joining tree using 16S rRNA gene sequences shows that M. ramae sp. nov. forms a cluster with M. rude whereas M. lamarrei belongs to a separate clade. It is well established that morphologically M. lamarrei and M. rude are very easily distinguishable species and could be identified easily. M.rude differs hugely from M.ramae sp. nov. in having larger males than females measuring upto 130 mm of total length ,2nd cheliped 1.5 times longer than total body length .Moreover, all the sengments of 2nd cheliped bear velvety pubescence, hence known as ‘hairy river prawn’. M. lamarrei also differs significantly from M.ramae sp. nov. in having longer rostrum with characteristic edentate gap, non-hairy appendix masculina longer than 2nd pleopodal endopod and absence of subapical spine in uropodal exopod. If the sequences submitted to NCBI for M. lamarrei and M. rude are accurate in terms of species identification, then the sequences generated during the current study using COI and 16S rRNA genes should show similarity with any one of the species for both the gene fragments. This indicates that the samples for M. lamarrei and M. rude were collected and sequences were submitted without proper confirmation of the taxonomic status of those species, making their identification done rather doubtful. The sequences of M. lamarrei and M. rude retrieved from NCBI were submitted by three different research groups from two different countries. COI gene sequences MT483220 and MT483221, submitted as M. lamarrei were collected from Bhairab river, Bangladesh which is a coastal river carrying estuarine water. 16S rRNA sequences AY858836 and MG283139, submitted as M. rude were collected from Tamil Nadu and Orissa states of India respectively. These sequences rather indicate the presence of M. ramae sp. nov. in those locations and often be misidentified as other species of Macrobrachium and hence providing a hint of distribution of M. ramae sp. nov. spanning from coast of Bangladesh to entire east coast of India. Conclusion. The results of phylogenetic analysis have clearly pointed out that M. ramae sp. nov. is a new species as indicated through detail morphological study conducted during the present study. The results show the importance of both morphological and molecular data for accurate identification of any species and would surely help future taxonomists to figure out species level identification of the genus Macrobrachium in India with more clarity. A NeW SPeCIeS OF PALAeMONID PRAWN Zootaxa 4952 (3) © 2021 Magnolia Press · 545 546 · Zootaxa 4952 (3) © 2021 Magnolia Press TABle 2.Comparison of Macrobrachium ramae sp. nov. with similar species Characters Macrobrachium gurudeve Jayachandran & Raji, 2004 Macrobrachium kunjuramanii Jayachandran & Raji, 2004 Macrobrachium saengphani Saengphan et al., 2020 Macrobrachium jayasreei Jayachandran & Raji, 2004 Macrobrachium ramae sp. nov. Rostrum Broad, sub distal to antennal scale, rostral formula: 7–9/3–5, usually 8/4 , 1st ventral tooth at 2/3rd distance of rostrum. Broad, extends as far as antennal scale, rostral formula: 7–9/3–5, usually 8/4 , 1st ventral tooth at half distance of rostrum. Slender, extends beyond or slightly shorter than end of antennal scale, upturned distally,rostral formula 68/4-5, 1st ventral tooth 2/5th distance of rostrum. Slender,subdistal to antennal scale,distal part curved upwards,rostral formula 7–8/4–5,1st ventral tooth at half distance of rostrum. Broad,over reaching antennal scale, straight, tip directed upwards in males,rostral formula 9–12/3–5, 1st ventral tooth at half distance of rostrum. Carapace Shorter than rostrum. Shorter than rostrum Shorter than rostrum Longer than rostrum. Longer than rostrum. length of the segments of antennular peduncle 3.5(p):2.0(m):2.75(d) 3.5(p):2.0(m):2.5(d) Not mentioned 3.0(p):1.75(m):2.0(d) 5.5(p):2.0(m):3.0(d) Antennal spine With carina. With carina. Without carina Without carina. With carina. 2 Cheliped 0.65 times as long as body, carpus shorter than propodus, fingers 3/4th as long as palm. 0.40–0.65 times as long as body, carpus longer than propodus, fingers half as long as palm. 0.50 times as long as of body,carpus longer or as long as chela,fingers subequal to palm length 0.50 times as long as body, carpus longer than propodus, fingers half as long as palm. 0.52–0.63 times as long as body, carpus shorter than propodus, fingers longer than palm in males. Appendix masculina Distal end with 1 long and 4 short stiff spinous setae and two rows of 13 and 4 lateral stiff setae. Distal end with 3 stiff spinous setae and 6 lateral setae. Distal end with numerous stiff setae. Distal end with 6 stiff setae and 9 stiff lateral setae. Distal end with 1 short and 2 long stiff setae and two rows of 12–14 lateral spinous setae. Uropodal exopod Without accessory spine. With accessory spine. With accessory spine. Without accessory spine. With accessory spine. Telson Broad, tip sharp, inner pair of distal spines very short. Slender, tip sharp, inner pair of distal spines longer than outer distal pairs. Slender,tip sharp with bulging mid-section, inner pair of distal spines 2-3 times longer than telson tip. Slender; tip sharp, inner pair of distal spines very long. Broad, tip with a median blunt projection, inner pair of distal spines long extending beyond telson tip. Relative length of sex. Males smaller than females. Males larger than females. Males smaller than females. Males smaller than females. Males smaller than females. nd DAS eT AL. FIGuRe 3. Macrobrachium ramae sp. nov. A.Tip of 2nd pereiopod of male,A.i.Sharp ridge ; B.2nd pleopod,B.i.Appendix masculina, B.ii.endopod ; C.Tip of Appendix masculina,C i , iii. Long apical setae,C ii.Short apical setae; D.Chela of male 2nd pereiopod,D.i.Cutting edge without teeth; e.Colour of live; F.Mandibular palp,F.i.Apical segment,F.ii.Middle segment,F.iii. Basal segment. A NeW SPeCIeS OF PALAeMONID PRAWN Zootaxa 4952 (3) © 2021 Magnolia Press · 547 FIGuRe 4. Phylogenetic relationship of Macrobrachium ramae with different Macrobrachium species using COI gene sequences. MW421978, MW421979, MW421980, MW421981 are the four COI gene sequences generated during current study and MT438420, MT438421, MK792418, MT235929, MT235930, AB250516, AB250543 and MT086577 are the reference sequences retrieved from NCBI. FIGuRe 5. Phylogenetic relationship of Macrobrachium ramae with different Macrobrachium species using 16S rRNA gene sequences. MW414676, MW414677, MW414678, MW414679, MW414680 are the five 16S rRNA sequences generated during current study and AY858836, MG283139, DQ194942, DQ194944, KP081673, KP081680, AY730051, AB250421, AB250422, eU493149, KM455124 are the reference sequences retrieved from NCBI. 548 · Zootaxa 4952 (3) © 2021 Magnolia Press DAS eT AL. etymology. This new species is named in loving memory of the grandmother of the corresponding author (MD), late Rama Sengupta, who was a constant inspiration to her.The species name is a noun in the genitive singular. Aknowledgement This study was financially supported by the West Bengal Biodiversity Board, Ministry of environment and Forest, Government of West Bengal, India [513/5k (bio) - 4/2018/dt .11/06/2018]. Authors are grateful to Dr. Anup Mandal, Project Manager & In-Charge, Central Aquaculture Genetics & Pathology Laboratory, Rajiv Gandhi Centre for Aquaculture, Sirkhazhi, Tamil Nadu, India for developing DNA sequence data and validating sexual dimorphism. Authors are also thankful to the Principal, Tamralipta Mahavidyalaya, Tamluk for providing laboratory facilities. References Cai, Y. & Vidthayanon, C. (2016) Macrobrachium spelaeus, a new species of stygobitic freshwater prawn from Thailand (Decapoda:Palaemonidae). Raffles Bulletin of Zoology, 64, 117–122. Chace, F.A. & Bruce, A.J. (1993) The caridean shrimps (Crustacea: Decapoda) of the ‘Albatross’ Philippine expedition 1907– 1910, part 6: Superfamily Palaemonoidea. Smithsonian Contributions to Zoology, 543(543), 1–152. https://doi.org/10.5479/si.00810282.543 De Grave, S. & Fransen, C.H.J.M. (2011) Carideorum catalogus: the recent species of the dendrobranchiate, stenopodidean, procarididean and caridean shrimps (Crustacea: Decapoda). Zoologische Mededelingen, 85 (9), 195–589. Holthuis, L.B. (1950a) The decapod of the siboge expedition. Part X. the Palaemonidae collected by the Siboga and Snellius expeditions, with remarks on other species, part I: Sub family Palaemoninae. Siboga expedition Leiden, 39, 1–268. Holthuis, L.B. (1950b) Preliminary descriptions of twelve new Species of Palaemonid prawns from American waters (Crustacea: Decapoda). Proceedings van de Koninklijke Nederlandsche Akademie van Wetenschappen, C, 53, 93–99. Jayachandran, K.V. (2001) Palaemonid Prawns- Biodiversity, Taxonomy, Biology and Management. Oxford and IBH Publ. Company Pvt. Ltd., New Delhi, Calcutta, 624 pp. Jayachandran, K.V. & Raji, A.V. (2004) Three new species of Macrobrachium Bate, 1868 (Decapoda, Palaemonidae) from the Western Ghats of Kerala State, India. Crustaceana, 77 (10), 1179–1192. https://doi.org/10.1163/1568540043166100 Jose, D. & Harikrishnan, M. (2019) evolutionary history of genus Macrobrachium inferred from mitochondrial markers: a molecular clock approach. Mitochondrial DNA Part A 30, 92– 100. https://doi.org/10.1080/24701394.2018.1462347 Kemp, S. (1917) Leander styliferus Milne edwards, and related Forms, Notes on Crustacea, Decapoda in the Indian Museum, IX. Records of the Indian Museum, 13, 203–231. https://doi.org/10.5962/bhl.part.5860 Liu, M.Y., Cai, Y.X. & Tzeng, C.S. (2007) Molecular systematics of the freshwater prawn genus Macrobrachium Bate, 1868 (Crustacea, Decapoda, Palaemonidae) inferred from mtDNA sequences, with emphasis on east Asian species. Zoological Studies, 46 (3), 279–28. Mandal, A., Varkey, M., Sobhanan, S.P., Mani, A.K., Gopalakrishnan. A., Ganesh, K., Arulraj, S., Pandiarajan, S. & Thampisamraj, Y.C. (2014) Molecular markers reveal only two mud crab species of Genus Scylla (Brachyura: Portunidae) in Indian coastal waters. Biochemical Genetics, 52, 338–354. https://doi.org/10.1007/s10528-014-9651-z Pahari, P.R., Das. M. & Bhattacharya, T. (2020) Palaemonid prawns of Purba Medinipur with two new records from West Bengal. ecology environment & Conservation, 26 (2), 348–354. Pillai, P.M. & Unnikrishnan, V. (2012) A new species of Macrobrachium (Decapoda, Palaemonidae) from Vamanapuram River, Southern Kerala, S. India. Zootaxa, 3528 (1), 63–68. https://doi.org/10.11646/zootaxa.3528.1.5 Pillai, P.M. & Unnikrishnan, V. (2013a) Morphology and molecular phylogeny of Macrobrachium snpurii, a new species of the genus Macrobrachium Bate, 1868 from Kerala, India. Zootaxa, 3664 (4), 434–444. https://doi.org/10.11646/zootaxa.3664.4.2 Pillai, P.M. & Unnikrishnan, V. (2013b) A replacement name for Macrobrachium aemulum madhusoodani, a junior homonym of Macrobrachium madhusoodani Unnikrishnan et al. 2011 (Decapoda: Palaemonidae). Zootaxa, 3741 (3), 400– 400. https://doi.org/10.11646/zootaxa.3741.3.9 Pillai, P.M., Unnikrishnan, V. & Sureshkumar, U. (2014) Description, DNA barcode and phylogeny of a new species, Macrobrachium abrahami (Decapoda: Palaemonidae) from Kerala, India. Zootaxa, 3768 (5), 546– 556. https://doi.org/10.11646/zootaxa.3768.5.2 Pillai, P.M., Unnikrishnan, V. & Prasannan, K. (2015) Macrobrachium indianum (Decapoda: Palaemonidae), a new species of hill A NeW SPeCIeS OF PALAeMONID PRAWN Zootaxa 4952 (3) © 2021 Magnolia Press · 549 stream prawn from Pambar River, Kerala, India. Zootaxa, 3936 (4), 559–566. https://doi.org/10.11646/zootaxa.3936.4.5 Radhakrishnan, e.V., Deshmukh, V.D., Maheswarudu, G., Josileen, J., Dineshbabu, A.P. Philipose, K.K., Sarada, P.T., Lakshmi Pillai, S., Saleela, K.N., Chakraborty, R., Dash, G., Sajeev, C.K., Thirumilu, P., Sridhara, B., Muniyappa, Y., Sawant, A.D., Vaidya, N.G. Dias Johny, R., Verma, J.B., Baby, P.K., Unnikrishnan, C., Ramachandran, N.P., Vairamani, A., Palanichamy, A., Radhakrishnan, M. & Raju, B. (2012) Prawn fauna (Crustacea: Decapoda) of India - An annotated checklist of the Penaeoid, Sergestoid, Stenopodid and Caridean prawns. Journal of the Marine Biological Association of India, 54 (1),50–72. Rossi, N., Magalhães, M., Mesquita, e.R. & Mantelatto, F.L. (2020) Uncovering a hidden diversity: a new species of freshwater shrimp Macrobrachium (Decapoda: Caridea: Palaemonidae) from Neotropical region (Brazil) revealed by morphological review and mitochondrial genes analyses. Zootaxa, 4732 (1), 177–195. https://doi.org/10.11646/zootaxa.4732.1.9 Sambrook, J., Fristisch, e.F. & Maniatis, T. (1989) Molecular cloning: A laboratory manual, 2nd edn. Cold Spring Harbor Laboratory Press, New York, 1626 pp. Saengphan, N., Panijpan, B., Senapin, S., Laosinchai, P., Ruenwongsa, P., Suksomnit, A. & Phiwsaiya, K. (2018) Morphology and molecular phylogeny of Macrobrachium suphanense sp. nov. (Decapoda: Palaemonidae) from Thailand. Zootaxa, 4482 (1), 151–163. https://doi.org/10.11646/zootaxa.4482.1.7 Saengphan, N., Panijpan, B., Senapin, S., Laosinchai, P., Suksomnit, A. & Phiwsaiya, K. (2020) Morphology and molecular phylogeny of Macrobrachium saengphani sp. nov.(Decapoda: Palaemonidae) from Northern Thailand Zootaxa, 4868 (4), 531–542. https://doi.org/10.11646/zootaxa.4868.4.4 Short, J.W. (2004) A revision of Australian river prawns, Macrobrachium (Crustacea: Decapoda: Palaemonidae). Hydrobiology, 525 (1–3), 1–100. https://doi.org/10.1023/B:HYDR.0000038871.50730.95 Tamura, K., Stecher, G., Filipski, A. & Kumar, S. (2013) MeGA6: Molecular evolutionary Genetics Analysis version 6.0. Molecular Biology and evolution, 30, 2725–2729. https://doi.org/10.1093/molbev/mst197 Xuan, N.V. (2012) Macrobrachium hungi, a new freshwater palaemonid prawn (Decapoda: Caridea: Palaemonidae) from the Tonle Sap Great Lake of Cambodia. Zootaxa, 3560 (1), 32–40. https://doi.org/10.11646/zootaxa.3560.1.2 Zheng, X., Chen, W. & Guo, Z. (2019) The genus Macrobrachium (Crustacea, Caridea, Palaemonidae) with the description of a new species from the Zaomu Mountain Forest Park, Guangdong Province, China. ZooKeys, 866, 65–83. https://doi.org/10.3897/zookeys.866.32708 550 · Zootaxa 4952 (3) © 2021 Magnolia Press DAS eT AL.