AUTHORS’ PAGE PROOFS: NOT FOR CIRCULATION CSIRO PUBLISHING Invertebrate Systematics https://doi.org/10.1071/IS18035 Combining morphological and molecular data resolves the phylogeny of Squilloidea (Crustacea : Malacostraca) LY Cara Van Der Wal A,B,E, Shane T. Ahyong B,C, Simon Y. W. Ho A, Luana S. F. Lins D and Nathan Lo A A School of Life and Environmental Sciences, University of Sydney, Sydney, NSW 2006, Australia. Australian Museum Research Institute, Australian Museum, 1 William Street, Sydney, NSW 2000, Australia. C School of Biological, Earth and Environmental Sciences, University of New South Wales, Kensington, NSW 2052, Australia. D School of Biological Sciences and Center for Reproductive Biology, Washington State University, 100 Dairy Road, Pullman, WA 99164, USA. E Corresponding author. Email: cara.vanderwal@sydney.edu.au 10 Abstract. The mantis shrimp superfamily Squilloidea, with over 185 described species, is the largest superfamily in the crustacean order Stomatopoda. To date, phylogenetic relationships within this superfamily have been comprehensively analysed using morphological data, with six major generic groupings being recovered. Here, we infer the phylogeny of Squilloidea using a combined dataset comprising 75 somatic morphological characters and four molecular markers. Nodal support is low when the morphological and molecular datasets are analysed separately but improves substantially when combined in a total-evidence phylogenetic analysis. We obtain a well resolved and strongly supported phylogeny that is largely congruent with previous estimates except that the Anchisquilloides-group, rather than the Meiosquillagroup, is the earliest-branching lineage in Squilloidea. The splits among the Anchisquilloides- and Meiosquilla-groups are followed by those of the Clorida-, Harpiosquilla-, Squilla- and Oratosquilla-groups. Most of the generic groups are recovered as monophyletic, with the exception of the Squilla- and Oratosquilla-groups. However, many genera within the Oratosquilla-group are not recovered as monophyletic. Further exploration with more extensive molecular sampling will be needed to resolve relationships within the Oratosquilla-group and to investigate the adaptive radiation of squilloids. Overall, our results demonstrate the merit of combining morphological and molecular datasets for resolving phylogenetic relationships. PRO OF 5 ON B Additional keywords: mantis shrimp, molecular phylogeny, morphological phylogeny, Stomatopoda, total-evidence analysis. Received 10 April 2018, accepted 20 July 2018, published online dd mmm yyyy Introduction Squilloidea is the largest superfamily of the crustacean order Stomatopoda (mantis shrimps), containing ~40% of all known species (Ahyong 2001, 2005). Squilloidea comprises a single 5 family, Squillidae, which is morphologically diverse and includes over 185 species in 49 genera (Van Der Wal and Ahyong 2017). Exclusively composed of species that use ‘spearing’ to catch prey, squilloids are active predators in muddy and sandy substrates on tropical and temperate coastal and continental 10 shelf habitats (Manning 1977; Abelló and Martin 1993; Ahyong 2005, 2013). The superfamily originated ~70 million years ago (Van Der Wal et al. 2017) and is present in both of the major tropical marine regions, being found throughout the Atlanto-East Pacific and Indo-West Pacific. 15 Stomatopods form an important component of marine ecosystems and are economically significant. Simulations of Journal compilation
CSIRO 2018 increased trawling efforts on stomatopod populations have shown a negative effect on populations of other marine invertebrates and fishes, such as mackerel (Antony et al. 2010). Several major fisheries target Squilla mantis Linnaeus, 1758, in the Mediterranean (Abelló and Martin 1993; Maynou 5 et al. 2004) and Oratosquilla oratoria (de Haan, 1844) in Japan and China (Zhang et al. 2012), as well as numerous artisanal fisheries throughout south-east Asia and east Africa (Ahyong et al. 2009a; Wardiatno and Mashar 2010). The taxonomy and classification of the squilloids has been 10 significantly revised in the past five decades, but largely without the benefit of formal phylogenetic analysis (Manning 1968, 1971; Ahyong 1997, 2000; Ahyong et al. 2000). The phylogeny of the squilloids has only recently been studied in detail, based on somatic morphology (Ahyong 2005). Six 15 generic groups were recognised within Squilloidea (Fig. 1): the www.publish.csiro.au/journals/is C. Van Der Wal et al. LY Invertebrate Systematics ON (A) (C) (B ) PRO OF B ( D) (E ) (F) Fig. 1. Representative squilloids. A, Rissoides desmaresti (Risso, 1816) (Meiosquilla-group); B, Anchisquilloides mcneilli (Stephenson, 1953), posterior abdomen and telson (Anchisquilloides-group); C, Clorida latreillei Eydoux & Souleyet, 1842 (Clorida-group); D, Harpiosquilla harpax (de Haan, 1844) (Harpiosquilla-group); E, Squilla mantis (Linnaeus, 1758) (Squilla-group); F, Oratosquilla fabricii (Holthuis, 1841) (Oratosquillagroup). A, E, modified after Manning 1977: Figs 40 and 48, respectively; B, modified after Ahyong 2012: Fig. 37; C, D, modified after Holthuis and Manning 1969: Figs 349 and 347, respectively; F, modified after Holthuis 1941: Fig. 1. Squilloid phylogeny 20 25 30 DNA extraction, amplification, and sequencing DNA was extracted from the branchial tissue using a modified version of the Chelex rapid-boiling procedure (Walsh et al. 1991; Ahyong and Jarman 2009). Four molecular markers were selected for amplification based on their ability to resolve stomatopod and crustacean relationships in previous studies (Lavery et al. 2004; Ahyong and Jarman 2009). Regions of one nuclear gene (28S rRNA D1 expansion region, 28S) and three mitochondrial genes (12S rRNA (12S), 16S rRNA (16S), and cytochrome c oxidase subunit I (CO1)) were amplified using polymerase chain reaction (PCR) and four sets of primers (Table 2). The D1 expansion region of the 28S rRNA gene was selected based on previous phylogenetic analyses of crustaceans by Ahyong and O’Meally (2004), Ahyong et al. (2009b), and Schnabel et al. (2011). PCR cycle conditions varied for each primer set. The 28S cycle parameters consisted of initial denaturation for 2 min at 94
C, 30 cycles of 1 min denaturing at 94
C, 1 min annealing at 50
C, and 2 min elongation at 72
C, followed by 7 min final extension at 72
C (Ahyong et al. 2009b; Schnabel et al. 2011). The 12S cycle parameters consisted of 29 cycles of 2 min denaturation at 92
C, 2 min annealing at 54
C, and 3 min elongation at 72
C, and with the final cycle having an elongation time of 10 min (Mokady et al. 1994; Mokady and Brickner 2001). The 16S cycle parameters consisted of 30 cycles of 0.5 min denaturing at 94
C, 1 min annealing at 50
C, and 1.5 min elongation at 72
C, followed by 6 min final extension at 72
C (Ahyong and Jarman 2009). The CO1 cycle parameters consisted of initial denaturation for 2 min at 96
C, 40 cycles of 1 min denaturing at 96
C, 1 min annealing at 52
C, and 1 min elongation at 72
C, followed by 10 min final extension at 72
C. Sanger sequencing was performed by Macrogen (Seoul, South Korea). Contigs of forward and reverse sequences were separately aligned in Sequencher 5.0.1 (Gene Codes Corporation, Ann Arbor, MI, USA) using default assembly parameters. Sequences for each gene were then combined with those available from GenBank. The MUSCLE 3.8.31 algorithm (Edgar 2004) was used to align the sequences from each of the genes. Manual modifications were then made to each alignment. The final concatenated sequence alignment consisted of 1695 base pairs (bp): 295 bp from 28S (47 taxa), 303 bp from 12S (45 taxa), 445 bp from 16S (46 taxa), and 600 bp from CO1 (41 taxa). Xia’s test in DAMBE 6 (Xia 2013) was used to check for saturation of nucleotide substitutions. We found no evidence of saturation in the 28S, 16S, and CO1 datasets (Table S2). Some saturation was evident in 12S when an asymmetrical topology was assumed for the simulations used to determine the critical value for the saturation test, but this was not the case when a symmetrical topology was assumed. Therefore, we retained the 12S sequences in our dataset for all of our phylogenetic analyses. LY 15 Materials and methods Taxon sampling Fifty ingroup squilloid species, representing 29 of the 49 recognised genera, were included in this study (Table 1). 35 Sequences were either generated de novo or obtained from GenBank. Tissue samples were collected from specimens provided by the Australian Museum, Sydney (AM), Muséum National d’Histoire Naturelle, Paris (MNHN), National Institute of Water and Atmospheric Research, Wellington, New Zealand 40 (NIWA), and Florida Museum of Natural History (FLMNH). Species from the stomatopod superfamily Parasquilloidea were selected as outgroups, based on their close relationship to Squilloidea (Ahyong and Harling 2000; Porter et al. 2010; Van Der Wal et al. 2017). The three outgroup species were 45 Faughnia formosae Manning & Chan, 1997, F. profunda Manning & Makarov, 1978, and F. serenei Moosa, 1982 (Table 1). Morphological characters All 53 terminal taxa in the dataset were scored morphologically (Table S1, available as Supplementary Material). The 50 morphological matrix includes 75 variable characters used by Ahyong (2005) (see Ahyong 2005 for character descriptions and states). For analytical purposes we excluded Characters 27 (abdominal somites 1–5 lateral carinae) and 41 (telson submedian carina) from the study by Ahyong (2005) because 55 these characters were invariant for taxa represented in our dataset. The matrix was constructed in MacClade 4.0 C (Maddison and Maddison 2000); all characters are unordered and equally weighted. ON 10 Meiosquilla-, Anchisquilloides-, Clorida-, Harpiosquilla-, Squilla, and Oratosquilla-groups (Ahyong 2005). Among these groups, general morphological trends include a change in telson shape from triangular with articulated submedian teeth to subquadrate with fixed submedian apices, increasingly pronounced dorsal carination, development of the sound-producing stridulatory carinae of the ventral surface of the telson, a tendency towards lateral bilobation of the thoracic somites, and increasing body size. The Oratosquilla-group is the most speciose of the six groups and is considered the ‘most highly derived’ (Ahyong 2005). Although the morphological diversity within Squilloidea is well documented, the superfamily has not yet been analysed using a molecular phylogenetic approach. Further, no studies of Squilloidea or Stomatopoda have taken an integrative or totalevidence approach by combining morphological and molecular data for phylogenetic inference. Despite the long-standing debate over the relative utility of morphological and molecular characters for resolving evolutionary relationships, both sources of information are potentially valuable (Wiens 2004; Heikkilä et al. 2015). In this study we test previous morphological estimates of the phylogeny of Squilloidea. First, we present a morphological dataset and use it to infer the evolutionary relationships within the superfamily. Second, we present the most comprehensive molecular phylogenetic estimate of the group to date. Using these datasets in combination, we carry out the first totalevidence phylogenetic analysis within Stomatopoda, allowing us to compare the inferred relationships and to evaluate congruence in the phylogenetic signal across datasets. PRO OF 5 Invertebrate Systematics 5 10 15 20 25 30 35 40 45 50 Phylogenetic analysis of morphological data We analysed the morphological dataset, comprising 75 characters, 55 using both maximum likelihood (ML) and Bayesian inference. D Invertebrate Systematics C. Van Der Wal et al. Table 1. Terminal taxa analysed in this study, with their voucher codes for new sequences and GenBank accession numbers Dashes (–) indicate missing sequences. AM, Australian Museum, Sydney; FLMNH, Florida Museum of Natural History, Gainsville; MNHN, Muséum national d’Histoire naturelle, Paris; NIWA, National Institute of Water & Atmospheric Research, Wellington Alima orientalis Manning, 1978 Alima pacifica Ahyong, 2001 Alima pacifica Ahyong, 2001 Anchisquilla fasciata (de Haan, 1844) Anchisquilloides mcneilli (Stephenson, 1953) Belosquilla laevis (Hess, 1865) Busquilla plantei Manning, 1978 Busquilla quadraticauda (Fukuda, 1911) Carinosquilla multicarinata (White, 1849) Clorida decorata (Wood-Mason, 1875) Cloridina moluccensis (Moosa, 1973) Cloridopsis scorpio (Latreille, 1828) Dictyosquilla foveolata (Wood-Mason, 1895) Erugosquilla grahami Ahyong & Manning, 1998 Erugosquilla woodmasoni (Kemp, 1911) Fallosquilla fallax (Bouvier, 1914) Harpiosquilla annandalei (Kemp, 1911) Harpiosquilla harpax (de Haan, 1844) Harpiosquilla japonica Manning, 1969 Harpiosquilla melanoura Manning, 1968 Kempella mikado (Kemp & Chopra, 1921) Kempella stridulans (Wood-Mason in Alcock, 1894) Lenisquilla lata (Brooks, 1886) Leptosquilla schmeltzii (A. Milne-Edwards, 1873) Levisquilla jurichi (Makarov, 1979) Lophosquilla costata (de Haan, 1844) Meiosquilla dawsoni Manning, 1970 Meiosquilla swetti (Schmitt, 1940) Miyakella holoschista (Kemp, 1911) Miyakella nepa (Latreille, 1828) Oratosquilla fabricii (Holthuis, 1941) Oratosquilla oratoria (de Haan, 1844) Oratosquillina anomala (Tweedie, 1935) Oratosquillina asiatica (Manning, 1978) Oratosquillina inornata (Tate, 1883) Oratosquillina interrupta (Kemp, 1911) Oratosquillina nordica Ahyong & Chan, 2008 Oratosquillina perpensa (Kemp, 1911) Pterygosquilla schizodontia (Richardson, 1953) Quollastria gonypetes (Kemp, 1911) Quollastria imperialis (Manning, 1965) Rissoides barnardi (Manning, 1975) Squilla chydaea Manning, 1962 Squilla edentata (Lunz, 1937) Squilla empusa Say, 1818 Squilla rugosa (Lunz, 1937) Squilloides leptosquilla (Brooks, 1886) Triasquilla profunda Ahyong, 2013 Vossquilla kempi (Schmitt, 1931) 12S 16S CO1 MNHN IU-2010-2505, Madagascar AM P.60117, Australia MH168167 MH168125 MH168208 – MH168190 – MH168155 MH168170 MH168157 MH168189 HM180003 MH168184 MH168182 – MH168168 MH168194 MH168196 MH168187 MH168186 HM180009 MH168158 MH168160 MH168159 – MH168156 MH168150 AF107604 MH168112 MH168128 MH168115 MH168148 – MH168143 MH168141 MH168114 MH168126 – – MH168146 MH168145 – MH168117 MH168119 MH168118 MH168116 MH168113 MH168229 AF107607 HM138814 MH168211 – – HM138815 MH168223 MH168221 MH168200 MH168209 MH168234 MH168236 MH168226 MH168225 HM138821 MH168202 MH168203 – MH168201 MH168199 MH168271 – – MH168243 MH168242 MH168244 – MH168265 MH168256 MH168255 MH168247 MH168249 – MH168262 – MH168264 MH168261 MH168259 MH168260 MH168273 MH168172 MH168195 MH168183 MH168161 MH168197 MH168163 MH168169 – MH168162 MH168188 MH168173 MH168176 MH168198 MH168180 MH168178 MH168175 MH168177 MH168174 MH168165 MH168166 – MH168179 MH168181 MH168164 HM180042 MH168185 – MH168171 MH168130 – MH168142 MH168120 – MH168122 MH168127 MH168151 MH168121 MH168147 MH168131 MH168135 – MH168139 MH168137 MH168134 MH168136 MH168133 MH168123 MH168124 MH168149 MH168138 MH168140 AF107605 – MH168144 MH168132 MH168129 MH168213 MH168235 MH168222 MH168204 MH168237 MH168206 MH168210 MH168230 MH168205 MH168227 MH168214 MH168217 MH168238 MH168220 MH168219 – MH168218 MH168216 – MH168207 MH168228 – – AF107617 HM138854 MH168224 MH168215 MH168212 MH168263 – MH168246 – – MH168245 MH168272 MH168248 MH168269 MH168267 MH168274 MH168270 MH168268 MH168266 MH168251 MH168275 MH168278 MH168254 MH168277 MH168279 MH168250 MH168257 MH168258 – – MH168252 MH168253 MH168276 MH168193 MH168191 MH168154 MH168152 MH168233 MH168231 MH168239 MH168240 MH168192 MH168153 MH168232 MH168241 AM P.90966, Australia AM P.72232, Taiwan NIWA 55090, New Zealand AM P.74409, Australia AM P.60115, Taiwan AM P.72100, Taiwan AM P.51431, Macau AM P.102205, Gulf of Thailand AM P.67869, Singapore AM P.51433, Macau AM P.102212, Taiwan AM P.102213, Taiwan AM P.58281, Taiwan AM P.102206, Gulf of Thailand AM P.102236, Taiwan AM P.60566, Australia MNHN IU-2010-712, Mozambique AM P.67935, Taiwan AM P.102211, Taiwan AM P.62873, Fiji MNHN IU-2014-1126, Kavieng AM P.102214, Taiwan FLMNH UF8116, Panama FLMNH UF8079, Panama AM P.65699, Taiwan AM P.102207, Gulf of Thailand AM P.72326, Taiwan AM P.99512, Kinmen AM P.90372, Singapore AM, Taiwan, 1996-11-1 AM P.102210, Taiwan AM P.51435, Australia AM P.58288, Andaman Sea AM P.72327, Taiwan AM P.87907, New Zealand MNHN IU-2010-3523, Mozambique AM P.72349, Taiwan MNHN Sto1993, Mozambique AM P.102231, Gulf of Mexico AM P.102232, Gulf of Mexico AM P.102230, Gulf of Mexico PRO OF Q3 28S D1 region LY Squilloidea, Squillidae Alima maxima Ahyong, 2002 Voucher ON Taxon Outgroups (Parasquilloidea, Parasquillidae) Faughnia formosae Manning & Chan, 1997 Faughnia profunda Manning & Makarov, 1978 Faughnia serenei Moosa, 1982 AM P.102208, Taiwan AM P.102219, Philippines AM P.99511, Kinmen AM P.102215, Taiwan MNHN IU-2010-711/ MNHN IU-2010-1636, Mozambique AM P.72335, Taiwan Squilloid phylogeny Invertebrate Systematics E Table 2. Primers used in this study to amplify the nuclear 28S D1 expansion region and mitochondrial 12S, 16S and CO1 Direction Name Sequence (50 –30 ) Reference 28S D1 region 28S D1 region 12S 12S 16S 16S CO1 CO1 Forward Reverse Forward Reverse Forward Reverse Forward Reverse 28S-F216 28S-R443 CTGAATTTAAGCATATTAATTAGKGSAGG CCGATAGCGAACAAGTACCGTGAGG GAAACCAGGATTAGATACCC TTTCCCGCGAGCGACGGGCG CGCCTGTTTATCAAAAACAT CCGGTCTGAACTCAGATCACGT GGTCAACAAATCATAAAGATATTGG TAAACTTCAGGGTGACCAAAAAATCA Ahyong et al. (2009b), Schnabel et al. (2011) Ahyong et al. (2009b), Schnabel et al. (2011) Mokady et al. (1994), Mokady and Brickner (2001) Mokady et al. (1994), Mokady and Brickner (2001) Ahyong and Jarman (2009) Ahyong and Jarman (2009) Folmer et al. (1994) Folmer et al. (1994) 16Sar-L 16Sbr-H LCO1490 HC02198 nucleotide sites described above. The dataset was analysed using ML and Bayesian inference. The ML analyses were performed in RAxML. The Mkv model was applied to the morphological characters, whereas a separate GTR+G model was assigned to each of the subsets of the molecular data that were defined 5 according to the optimal partitioning scheme identified above. Two replicates of each analysis were performed to check for local optima, each using 10 random starts. Nodal support for the inferred topology was assessed by bootstrapping using 1000 pseudoreplicates of the data. 10 Bayesian phylogenetic analyses were conducted in MrBayes using the same partitioning scheme and substitution models as in the ML analysis. Posterior probabilities were estimated using Markov Chain Monte Carlo sampling, with one cold and three heated Markov chains. Samples were drawn every 2  103 steps 15 over a total of 2  107 steps, with the initial 25% of samples discarded as burn-in. To check for convergence, we ran analyses in duplicate and inspected the samples using Tracer. We used TreeAnnotator to identify the maximum-clade-credibility tree. 20 25 30 35 40 PRO OF ON The ML analysis was performed in RAxML 8.0.14 (Stamatakis 2014), using the Markovian Mkv model of character change (Lewis 2001). Two replicates of the analysis were performed to check for local optima, each using 10 random starts. To assess 5 nodal support for the inferred topology, we performed a bootstrapping analysis using 1000 pseudoreplicates of the data. Bayesian phylogenetic analyses were conducted in MrBayes 3.2.5 (Ronquist et al. 2012), using the Mkv model. Posterior probabilities were estimated using Markov Chain Monte Carlo 10 sampling, with one cold and three heated Markov chains. Samples were drawn every 2  103 steps over a total of 2  107 steps, with the initial 25% of samples discarded as burn-in. To check for convergence, the analysis was run in duplicate and the samples were inspected using the program Tracer 1.7.1 15 (Rambaut et al. 2018). We used TreeAnnotator 2.2.0, part of the BEAST package (Bouckaert et al. 2014), to identify the maximum-clade-credibility tree. LY Gene Phylogenetic analysis of molecular data The concatenated dataset of 28S, 12S, 16S, and CO1 was analysed using both ML and Bayesian inference. The bestfitting substitution models and data-partitioning scheme were selected using PartitionFinder 2.1.1 (Lanfear et al. 2016). The optimal partitioning scheme split the data into four subsets: nuclear 28S, mitochondrial 12S and 16S, first- and secondcodon sites of CO1, and third-codon sites of CO1. The ML analyses were performed in RAxML using the optimal partitioning scheme and with the GTR+G model for each data subset. Two replicates of each analysis were performed to check for local optima, each using 10 random starts. Nodal support for the inferred topology was assessed by bootstrapping using 1000 pseudoreplicates of the data. Bayesian phylogenetic analyses were conducted in MrBayes. The GTR+G model was used for each data subset. Posterior probabilities were estimated using Markov Chain Monte Carlo sampling, with one cold and three heated Markov chains. Samples were drawn every 2  103 steps over a total of 2  107 steps, with the initial 25% of samples discarded as burn-in. To check for convergence, we ran analyses in duplicate and inspected the samples using Tracer. We used TreeAnnotator to identify the maximum-clade-credibility tree. Phylogenetic analysis of combined data To perform a total-evidence phylogenetic analysis, we assembled a concatenated dataset containing 1770 characters, comprising the 75 variable morphological characters and 1695 Results 20 Separate analyses of morphological and molecular data The ML and Bayesian phylogenetic analyses of the morphological data produced trees with similar topologies (Fig. 2). Although nodal support varied throughout the tree, many nodes along the backbone received only moderate to weak support (<0.95 posterior probability and <75% bootstrap support). The estimated phylogeny recovered the six generic groups within Squilloidea recognised by Ahyong (2005). The Meiosquilla-group is recovered as the sister lineage to all remaining squilloids. With the exception of the Squilla-group, all groups are recovered as monophyletic. All genera represented in our dataset are recovered as monophyletic, with the exception of Oratosquillina Manning, 1995. The ML and Bayesian analyses of the molecular data yielded similar estimates of the squilloid tree (Fig. 3) and, as seen in the morphological results, overall nodal support along the backbone of the phylogeny is very weak. The six generic groups within Squilloidea recognised by Ahyong (2005) are largely recovered. However, the Anchisquilloides-group, rather than the Meiosquilla-group, is placed as the sister lineage to all remaining squilloids. The Meiosquilla- and Harpiosquillagroups are recovered as monophyletic. The Clorida-group, to the exclusion of Cloridopsis Manning, 1968, is monophyletic, albeit with weak bootstrap support. The Oratosquilla-group is not strictly monophyletic on the basis of Belosquilla laevis 25 30 35 40 45 Invertebrate Systematics C. Van Der Wal et al. Miyakea nepa Miyakea holoschista 0.66/69 Oratosquilla oratoria 0.39/38 Oratosquilla fabricii Oratosquillina asiatica 0.28/21 1/92 Busquilla quadraticauda 1/83 Busquilla plantei 0.21/20 0.34/89 Erugosquilla woodmasoni 0.03/0 Erugosquilla grahami Oratosquillina interrupta 0.05/2 Oratosquillina perpensa 0.46/17 0.12/19 Oratosquillina anomala Oratosquillina inornata 0.6/40 Oratosquillina nordica 0.92/66 Quollastria gonypetes 0.8/42 Quollastria imperialis 0.98/80 Carinosquilla multicarinata 0.98/83 Lophosquilla costata Dictyosquilla foveolata 0.87/56 0.33/65 Alima pacifica 1/98 Alima maxima 0.98/80 0.96/69 Alima pacifica 0.18/6 Alima orientalis 0.47/35 Vossquilla kempi Belosquilla laevis 1/100 Kempella mikado 1/88 Kempella stridulans 0.57/45 Squilla empusa 0.39/51 Squilla chydaea 0.3/30 Squilla edentata Squilla rugosa 0.23/10 Harpiosquilla melanoura 0.46/63 Harpiosquilla harpax 1/96 0.47/39 Generic groupings: LY Anchisquilloides Clorida Harpiosquilla Meiosquilla Oratosquilla ON Squilla 0.2 subs/site PRO OF F 1/96 0.98/94 Harpiosquilla japonica Harpiosquilla annandalei 0.47/36 1/96 Clorida decorata 0.98/81 Cloridina moluccensis Lenisquilla lata 0.69/41 0.38/36 Levisquilla jurichi 0.75/50 0.93/59 0.76/49 Fallosquilla fallax Leptosquilla schmeltzii 0.96/68 Anchisquilla fasciata Cloridopsis scorpio 1/100 Anchisquilloides mcneilli 0.98/95 Meiosquilla dawsoni 0.57/70 Meiosquilla swetti 0.96/58 Rissoides barnardi 0.96/53 Triasquilla profunda 0.85/54 Squilloides leptosquilla Pterygosquilla schizodontia 0.38/74 Faughnia profunda 1/100 Faughnia serenei Faughnia formosae Fig. 2. Phylogeny of Squilloidea inferred by Bayesian analysis of 75 morphological characters. Support values at nodes correspond to posterior probability and likelihood bootstrap percentages. Colours of taxon labels correspond to generic groups recognised by Ahyong (2005). Squilloid phylogeny Invertebrate Systematics Miyakella nepa Dictyosquilla foveolata 0.65/19 Erugosquilla woodmasoni Oratosquilla fabricii 1/97 0.32/3 Oratosquillina asiatica Oratosquilla oratoria 0.75/25 0.5/8 Erugosquilla grahami Busquilla plantei 0.4/6 0.94/64 Busquilla quadraticauda Quollastria imperialis 0.19/0 Kempella mikado 1/100 0.81/59 Kempella stridulans 0.15/2 Lophosquilla costata 0.21/1 Alima orientalis 0.46/5 Quollastria gonypetes Generic groupings: Vossquilla kempi Anchisquilloides Alima pacifica 0.29/1 0.87/43 Alima pacifica Clorida 0.32/21 Alima maxima Harpiosquilla Oratosquillina anomala 0.94/62 0.52/18 Meiosquilla Oratosquillina inornata 0.23/3 0.63/40 Oratosquillina interrupta 0.86/31 Oratosquilla Oratosquillina perpensa 0.53/7 Squilla Oratosquillina nordica Carinosquilla multicarinata 0.41/4 Miyakella holoschista Squilla edentata 0.99/89 0.17/1 Squilla chydaea Squilla rugosa 1/83 0.73/42 Squilla empusa Cloridopsis scorpio 0.14/0 Harpiosquilla harpax 0.98/98 0.99/98 Harpiosquilla melanoura 1/96 Harpiosquilla japonica 0.2 subs/site 0.37/21 Harpiosquilla annandalei Belosquilla laevis 0.43/4 Levisquilla jurichi 0.37/32 0.26/21 Lenisquilla lata 0.17/22 Leptosquilla schmeltzii 0.88/37 Clorida decorata 0.49/16 Fallosquilla fallax 1/88 0.26/3 Anchisquilla fasciata Cloridina moluccensis Pterygosquilla schizodontia 0.81/58 Squilloides leptosquilla 0.85/66 1/100 Triasquilla profunda 0.99/60 0.53/9 Rissoides barnardi Meiosquilla dawsoni 0.53/12 Meiosquilla swetti Anchisquilloides mcneilli Faughnia serenei 0.95/46 1/100 Faughnia profunda Faughnia formosae 0.64/28 PRO OF ON LY 0.39/14 Fig. 3. Phylogeny of Squilloidea inferred by Bayesian analysis of concatenated molecular (28S, 12S, 16S and CO1) data. Support values at nodes correspond to posterior probability and likelihood bootstrap percentages. Colours of taxon labels correspond to generic groups recognised by Ahyong (2005). G Invertebrate Systematics C. Van Der Wal et al. (Hess, 1865) being placed as the sister lineage to the Harpiosquilla-group, and due to the inclusion of Kempella Low & Ahyong, 2010 (Squilla-group). Most members of the Squilla-group form a clade in proximity 5 to the Oratosquilla-group, but Kempella is deeply nested among Oratosquilla-group genera. Moreover, Cloridopsis (Cloridagroup) is nested among Squilla-group exemplars of the genus Squilla Fabricius, 1787. As found by Ahyong (2005), the Oratosquilla-, Squilla- and Harpiosquilla-groups together 10 form a clade, though the inclusion of the Harpiosquilla-group within this clade is on the basis of an extremely short branch. Within the speciose Oratosquilla-group, several genera are not recovered as monophyletic, albeit usually on the basis of weak support, including Alima Leach, 1817, Erugosquilla Manning, 15 1995, Miyakella Ahyong & Low, 2013, Oratosquilla Manning, 1968, Oratosquillina, and Quollastria Ahyong, 2001. 25 30 35 40 Our ML and Bayesian analyses of the combined morphological and molecular data produced phylogenetic estimates that were consistent with each other (Fig. 4). In contrast with the trees inferred separately from morphological and molecular datasets, the total-evidence trees had consistently strong support for the nodes along their backbones. As in the trees from the separate morphological and molecular analyses, the total-evidence tree recovered the six generic groupings recognised by Ahyong (2005). In agreement with the molecular estimate, but contrary to the results from the morphology-only analysis, the sister lineage to all remaining squilloids is the Anchisquilloidesgroup, rather than the Meiosquilla-group. The Anchisquilloides-, Meiosquilla-, Clorida- and Harpiosquilla-groups are strongly supported as monophyletic. As in the tree inferred from molecular data, the Oratosquillagroup is not strictly monophyletic because of the outlier Belosquilla laevis, which groups with Squilla in the Squillagroup. Another outlier, Cloridopsis scorpio (Clorida-group), which was aligned with the Squilla-group in the molecular analysis, found a stable position within the Clorida-group in our analyses of the combined data. As with the analyses of molecular data, several Oratosquilla-group genera are not recovered as monophyletic. Discussion PRO OF 20 ON Total-evidence analysis of combined data that sound production via the stridulating carinae on the telson, and development of prelateral lobes on the telson, evolved on the stem lineage of Squilloidea rather than within the crown group, as previously inferred (Ahyong 2005). This would indicate that sound production and the prelateral lobes were subsequently lost in the Meiosquilla-group. The Clorida-group occupies a somewhat intermediate topological position in all of our phylogenetic estimates. This is followed by a clade containing the Harpiosquilla-group as the sister lineage to a clade containing the Squilla- and Oratosquilla-groups, of which all members possess subquadrate rather than trianguloid telsons, with fixed rather than articulated apices of the submedian primary teeth. Another important departure from the results of Ahyong (2005) is the non-monophyly of the Squilla-group in all three of our phylogenetic estimates. Ahyong (2005) recovered the Squilla- and Oratosquilla-groups as reciprocally monophyletic sister groups, with Kempella within the former. Our analyses of molecular data recover Squilla as paraphyletic, leading to the Oratosquilla-group, but our analyses of morphological and combined datasets support Squilla as monophyletic; in each case, however, Kempella aligns with the Oratosquilla-group. Porter et al. (2010) found a similar result using a smaller taxon set, but with similar markers. The position of Kempella in each of our estimates suggests that its phylogenetic placement requires further investigation. Kempella shares numerous synapomorphies with other members of the Squilla-group (Ahyong 2001, 2005) but, significantly, occurs only in the Indo-West Pacific alongside most members of the Oratosquilla-group. Conversely, all other members of the Squilla-group occur exclusively in the Atlanto-East Pacific, which has been largely isolated from the Indo-West Pacific since the Miocene. Kempella has been hypothesised as a relict member of the Squilla-group in the Indo-West Pacific (Ahyong 2005), but our present results suggest that it is possibly a member of the Oratosquilla-group plesiomorphically retaining Squilla-like features. The position as sister taxon to the Oratosquilla-group, as recovered by our total-evidence analysis, is consistent with the latter hypothesis. The placement of Belosquilla alongside Squilla in our phylogeny is morphologically plausible, given the characteristics of their male petasma. The lateral processes of thoracic somite 5 of Belosquilla are distinctly bilobed, as in other members of the Oratosquilla-group. However, as in members of the Squillagroup, the hook process of the petasma is elongated, as long as the tube process, and distally spiniform (rather than short with a rounded apex), and the posterolateral margin of the carapace is angular rather than rounded (Ahyong 2001). Thus, Belosquilla is, in several respects, morphologically intermediate between the Squilla- and Oratosquilla-groups. The only generic group weakly supported in our combined phylogeny is the Oratosquilla-group. This could be due to marker choice or attributable to an adaptive radiation having occurred in this group, whereby multiple evolutionary divergences occurred within a relatively short period of time. Such radiations tend to produce trees with very short internal branches that are difficult to resolve reliably (Rokas et al. 2005). This result has also been found in studies of other crustaceans, such as decapods (Porter et al. 2005; Hou et al. 2007; Pileggi and LY H Phylogenetic relationships within Squilloidea The topologies of our three phylogenetic estimates largely recover the generic groupings reported in previous morphology45 based analyses (Ahyong 2005). The trees inferred from molecular and combined datasets both recovered the Anchisquilloides- and Meiosquilla-groups as the earliestbranching lineages with strong support, although their relative positions are reversed compared with that inferred in our 50 morphological tree and by Ahyong (2005). These positions are well supported in our analysis, despite the missing 16S sequence for Anchisquilloides Manning, 1977. The result, however, warrants further corroboration through wider taxon sampling of the Anchisquilloides-group. Nevertheless, if the 55 Anchisquilloides-group, rather than the Meiosquilla-group, is the earliest-branching lineage in Squilloidea, then it is likely 5 10 15 20 25 30 35 40 45 50 55 Squilloid phylogeny Invertebrate Systematics 0.86/34 0.68/20 0.35/11 0.33/2 0.74/6 0.85/54 0.78/14 Generic groupings: 0.31/1 0.98/79 0.24/18 0.76/36 0.44/30 Anchisquilloides Clorida 0.34/1 0.84/31 ON Harpiosquilla Miyakea nepa Erugosquilla woodmasoni Oratosquilla fabricii 1/99 Oratosquillina asiatica Busquilla quadraticauda 1/99 Busquilla plantei Erugosquilla grahami Oratosquilla oratoria Quollastria imperialis Quollastria gonypetes Alima orientalis Carinosquilla multicarinata Oratosquillina anomala Oratosquillina inornata Oratosquillina perpensa Oratosquillina interrupta Oratosquillina nordica 0.75/100 Alima pacifica 1/93 Alima pacifica LY 0.51/15 0.83/13 Meiosquilla Alima maxima Dictyosquilla foveolata Lophosquilla costata 1/82 Vossquilla kempi 0.28/13 Miyakea holoschista Kempella mikado 1/100 1/78 Kempella stridulans Squilla empusa 0.93/67 Squilla rugosa 0.9/82 0.85/38 Squilla chydaea 0.79/75 1/77 Squilla edentata Belosquilla laevis Harpiosquilla melanoura 0.99/94 0.98/97 Harpiosquilla harpax 1/100 Harpiosquilla japonica Harpiosquilla annandalei 1/75 Clorida decorata 1/79 0.98/71 Cloridina moluccensis Lenisquilla lata 0.95/89 Leptosquilla schmeltzii 0.51/22 0.99/81 Fallosquilla fallax 0.98/58 Levisquilla jurichi 0.99/67 Anchisquilla fasciata Cloridopsis scorpio Triasquilla profunda 0.95/32 Rissoides barnardi 0.68/39 Pterygosquilla schizodontia 0.76/27 1/81 Squilloides leptosquilla Meiosquilla dawsoni 1/82 Meiosquilla swetti 0.84/28 Oratosquilla 0.84/61 PRO OF Squilla 0.3 subs/site 1/97 1/100 0.96/13 1/100 Anchisquilloides mcneilli Faughnia profunda Faughnia serenei Faughnia formosae Fig. 4. Total-evidence phylogeny of Squilloidea inferred by Bayesian analysis of concatenated morphological (75 characters) and molecular (28S, 12S, 16S, and CO1) data. Support values at nodes correspond to posterior probability and likelihood bootstrap percentages. Colours of taxon labels correspond to generic groups recognised by Ahyong (2005). I 15 20 25 30 35 Mantelatto 2010). Oratosquilla-group representatives are regarded as having the ‘most highly derived’ features among the squilloids (Ahyong 2005). In particular, these features include the bilobed lateral processes of thoracic somite 5 (usually also bilobation on somites 6 and 7) and a short, apically blunt hook process on the male petasma that is distinctly overreached by the tube process (except in Belosquilla). Within the Oratosquilla-group, most genera with multiple representatives are not recovered as monophyletic. The nonmonophyly of Alima in our analysis is consistent with the results of previous morphological (Ahyong 2001, 2002b, 2005) and molecular (Porter et al. 2010) analyses, suggesting that the genus is not a natural group. Alima is currently under revision. Ahyong (2001, 2005) identified Oratosquilla and Oratosquillina sensu Manning (1995) as both likely to be polyphyletic. Problematic taxa included members of the ‘gonypetes group’ within Oratosquillina (now removed to Quollastria Ahyong, 2001), the morphologically aberrant Oratosquilla kempi (Schmitt, 1931), and Oratosquilla fabricii (Holthuis, 1941), which display variability in the condition of the otherwise diagnostic anterior bifurcation of the median carina of the carapace (Ahyong 2001, 2002a, 2002b, 2005). This study corroborates the recognition of Quollastria and the recent removal of Oratosquilla kempi to its own genus, Vossquilla Van Der Wal & Ahyong, 2017 (Van Der Wal and Ahyong 2017), because representatives of neither Quollastria nor Vossquilla are closely related to Oratosquillina nor Oratosquilla sensu stricto. Notably, Oratosquilla fabricii and Oratosquillina asiatica (Manning, 1978) are recovered as sister species, both distant from their respective congeners. Despite their current generic classifications, Oratosquilla fabricii and Oratosquillina asiatica are very similar morphologically and their separation from both Oratosquilla and Oratosquillina sensu stricto corroborates the observation that the taxonomic status and composition of both genera require revision (Ahyong 2002b). The non-monophyly and dispersed positions of species of Miyakea, Quollastria and Erugosquilla may relate to missing or incomplete sequence data. Combining morphological and molecular data Our results show that combining morphological and molecular datasets generally leads to an improvement in topological robustness. The increase in nodal support when combining the morphological and molecular datasets was substantial, indicating congruence in their evolutionary signals. Combining data, 45 however, will not result in improved phylogenetic estimates if there are conflicts between the signals from the separate datasets (Ruhfel et al. 2013). Such incongruence between morphological and molecular data can result from differences in rates of molecular evolution and morphological change (Heikkilä 50 et al. 2015), model misspecification, and convergent evolution (San Jose et al. 2018). In our analyses of the combined dataset, the ‘outlier’ or ‘rogue’ taxa with unstable positions in our molecular estimate (Belosquilla laevis and Cloridopsis scorpio) were placed with 55 a high degree of confidence. This may be attributable to the amplification of the underlying phylogenetic signal when combining different forms of evidence, which has the potential 40 to override sources of phylogenetic noise and lead to improved estimates of evolutionary relationships (Lee et al. 2007; Heikkilä et al. 2015). Additionally, other studies have shown that combining morphological and molecular data can help to clarify phylogenetic relationships when molecular sequence data are incomplete or otherwise uninformative (Ruhfel et al. 2013; Bracken-Grissom et al. 2014). The substantial increase in support we observed when using a total-evidence approach is consistent with the results of other studies (Glenner et al. 2004; Wortley and Scotland 2006; Bieler et al. 2014). Bracken-Grissom et al. (2014) reported an increase in support throughout their decapod phylogeny, particularly for deep nodes, when combining morphological and molecular data. Furthermore, Near et al. (2003) obtained the highest phylogenetic resolution for icefishes when molecular and morphological data were combined. This result, however, is not universally obtained for total-evidence analyses. Some studies have reported that although analyses of combined data performed better than analyses of morphological data alone, superior estimates were obtained when analysing molecular data alone (Ruhfel et al. 2013). ON 10 C. Van Der Wal et al. 5 10 15 20 Conclusions Our study is the first to provide a comprehensive estimate of the phylogeny of Squilloidea using molecular data. It is also one of only two studies to investigate individual stomatopod superfamilies using molecular methods (Barber and Erdmann 2000). Additionally, it is the first study to infer a stomatopod phylogeny using a total-evidence approach. Using this approach, we have identified a compelling example of the advantages that can accrue from combining morphological and molecular data. Individually, each of our datasets produced a tree with very weak support. The use of a relatively small number of morphological characters substantially improved phylogenetic signal when using a total-evidence approach, generating a highly supported phylogeny. The similarity between our morphological, molecular, and combined phylogenetic estimates with that of Ahyong (2005) indicates consistency between the morphological and molecular phylogenetic signals. Our analysis has recovered most of the generic groupings within Squilloidea recognised by Ahyong (2005), with some notable outliers. Alternative positions for Belosquilla and Kempella compared with previous results suggest novel phylogenetic hypotheses that require further exploration. Contrary to the findings of Ahyong (2005), however, the Anchisquilloides-group, rather than the Meiosquillagroup, is inferred, with strong support, to be the sister group to all other squilloids. Although the squilloid phylogeny is well resolved, further explorations based on larger molecular datasets (e.g. mitochondrial genomes and multiple nuclear loci) will be highly beneficial. These will allow greater resolution of the relationships within the Oratosquilla-group, testing of the hypothesis of adaptive radiation, and estimation of the evolutionary timescale using molecular dating approaches. PRO OF 5 Invertebrate Systematics LY J Conflicts of interest The authors declare no conflicts of interest. 25 30 35 40 45 50 55 Squilloid phylogeny Invertebrate Systematics 15 20 25 30 Q1 35 40 45 50 55 60 References Abelló, P., and Martin, P. (1993). Fishery dynamics of the mantis shrimp Squilla mantis (Crustacea: Stomatopoda) population off the Ebro delta (northwestern Mediterranean). Fisheries Research 16, 131–145. doi:10.1016/0165-7836(93)90048-C Ahyong, S. T. (1997). Phylogenetic analysis of the Stomatopoda (Malacostraca). Journal of Crustacean Biology 17, 695–715. doi:10.2307/1549373 Ahyong, S. T. (2000). Redescription of Squilla fabricii Holthuis, 1941 (Crustacea: Stomatopoda), and its transfer to Oratosquilla Manning, 1968. Proceedings of the Biological Society of Washington 113, 926–930. Ahyong, S. T. (2001). Revision of the Australian stomatopod Crustacea. Records of the Australian Museum 26(Supplement), 300–310. doi:10.3853/j.0812-7387.26.2001.1333 Ahyong, S. T. (2002a). Stomatopod Crustacea from the Marquesas Islands: results of MUSORSTOM 9. Zoosystema 24, 347–372. Ahyong, S. T. (2002b). A new species and new records of Stomatopoda from Hawaii. Crustaceana 75, 827–840. doi:10.1163/156854002760289791 Ahyong, S. T. (2005). Phylogenetic analysis of the Squilloidea (Crustacea: Stomatopoda). Invertebrate Systematics 19, 189–208. doi:10.1071/ IS04037 Ahyong, S. T. (2012). ‘The marine fauna of New Zealand: mantis shrimps (Crustacea: Stomatopoda).’ (National Institute of Water and Atmospheric Research Ltd: Wellington, NZ). Ahyong, S. T. (2013). Stomatopoda collected primarily by the Philippine AURORA expedition (Crustacea, Squilloidea). In ‘Tropical Deep-Sea Benthos 27’. Mémoires du Muséum national d’Histoire naturelle, Paris. (Eds S. T. Ahyong, T. Y. Chan, L. Corbari, and P. K. L. Ng.) pp. 85–106. (Muséum national d’Histoire naturelle: Paris.) Ahyong, S. T., and Harling, C. (2000). The phylogeny of the stomatopod Crustacea. Australian Journal of Zoology 48, 607–642. doi:10.1071/ ZO00042 Ahyong, S. T., and Jarman, S. N. (2009). Stomatopod interrelationships: preliminary results based on analysis of three molecular loci. Arthropod Systematics & Phylogeny 67, 91–98. Ahyong, S. T., and O’Meally, D. (2004). Phylogeny of the Decapoda reptantia: resolution using three molecular loci and morphology. The Raffles Bulletin of Zoology 52, 673–693. Ahyong, S. T., Chan, T. Y., and Liao, Y. C. (2000). Oratosquillina manningi, a new species of stomatopod from Taiwan and Australia. Journal of Crustacean Biology 20, 42–47. doi:10.1163/1937240X-90000006 Ahyong, S. T., Chan, T. Y., and Liao, Y. C. (2009a). ‘A Catalog of the Mantis Shrimps (Stomatopoda) of Taiwan.’ (National Taiwan Ocean University: Taiwan.) Ahyong, S. T., Schnabel, K. E., and Maas, E. (2009b). Anomuran phylogeny: new insights from molecular data. In ‘Crustacean Issues. Vol. 18: Decapod Crustacean Phylogenetics’. (Eds J. W. Martin, K. A. Crandall, and D. L. Felder.) pp. 399–414. (CRC Press: Boca Raton, FL.) Antony, P. J., Dhanya, S., Lyla, P. S., Kurup, B. M., and Khan, S. A. (2010). Ecological role of stomatopods (mantis shrimps) and potential impacts of trawling in a marine ecosystem of the southeast coast of India. ON 10 PRO OF 5 The authors acknowledge Commonwealth funding from the Australian Biological Resources Study (ABRS) National Taxonomy Research Grant Program (NTRGP; Grant No. CH215-13) to CVDW. We thank Tin-Yam Chan (NTOU), Laure Corbari (MNHN), Sadie Mills (NIWA), and Gustav Paulay (FLMNH) for the loan of material. The authors acknowledge the University of Sydney’s high-performance computing cluster Artemis for providing the high-performance computing resources that contributed to the research results reported within this paper. Ecological Modelling 221, 2604–2614. doi:10.1016/j.ecolmodel.2010. 07.017 Barber, P. H., and Erdmann, M. V. (2000). Molecular systematics of the Gonodactylidae (Stomatopoda) using mitochondrial cytochrome oxidase c (subunit 1) DNA sequence data. Journal of Crustacean Biology 20, 20–36. doi:10.1163/1937240X-90000004 Bieler, R., Mikkelsen, P., Collins, T., Glover, E., González, V., Graf, D., Harper, E., Healy, J., Kawauchi, G., Sharma, P., Staubach, S., Strong, E., Taylor, J., Tëmkin, I., Zardus, J., Clark, S., Guzmán, A., McIntyre, E., Sharp, P., and Giribet, G. (2014). Investigating the Bivalve Tree of Life – an exemplar-based approach combining molecular and novel morphological characters. Invertebrate Systematics 28, 32–115. doi:10.1071/IS13010 Bouckaert, R., Heled, J., Kühnert, D., Vaughan, T., Wu, C., Xie, D., Suchard, M., Rambaut, A., and Drummond, A. (2014). BEAST 2: a software platform for Bayesian evolutionary analysis. PLoS Computational Biology 10(4), e1003537. doi:10.1371/journal.pcbi.1003537 Bracken-Grissom, H. D., Ahyong, S. T., Wilkinson, R. D., Feldmann, R. M., Schweitzer, C. E., Breinholt, J. W., Bendall, M., Palero, F., Chan, T. Y., Felder, D. L., Robles, R., Chu, K. H., Tsang, L. M., Kim, D., Martin, J. W., and Crandall, K. A. (2014). The emergence of the lobsters: phylogenetic relationships, morphological evolution and divergence time comparisons of an ancient group (Decapoda: Achelata, Astacidea, Glypheidea, Polychelida). Systematic Biology 63, 457–479. doi:10.1093/sysbio/syu008 de Haan, W. (1844). Crustacea. In ‘Fauna Japonica sive descriptio animalium, quae in itinere per Japoniam, jussu et auspiciis superiorum, qui summum in India Batava Imperium tenent, suspecto, annis 1823–1830 collegit, notis, observationibus et adumbrationibus illustravit’. (Ph. F. von Siebold.) plates. 38, 43–46, 48, 51–55, I–N. (Lugduni-Batavorum: Leiden, The Netherlands.) Edgar, R. C. (2004). MUSCLE: multiple sequence alignment with high accuracy and high throughput. Nucleic Acids Research 32, 1792–1797. doi:10.1093/nar/gkh340 Folmer, O., Black, M., Hoeh, W., Lutz, R., and Vrijenhoek, R. (1994). DNA primers for amplification of mitochondrial cytochrome c oxidase subunit I from diverse metazoan invertebrates. Molecular Marine Biology and Biotechnology 3, 294–299. Glenner, H., Hansen, A. J., Sorensen, M. V., Ronquist, F., Huelsenbeck, J. P., and Willerslev, E. (2004). Bayesian inference of the metazoan phylogeny: a combined molecular and morphological approach. Current Biology 12, 1828–1832. Heikkilä, M., Mutanen, M., Wahlberg, N., Sihvonen, P., and Kaila, L. (2015). Elusive ditrysian phylogeny: an account of combining systematized morphology with molecular data (Lepidoptera). BMC Evolutionary Biology 15, 260. doi:10.1186/s12862-015-0520-0 Holthuis, L. B. (1941). The Stomatopoda of the Snellius Expedition. Biological Results of the Snellius Expedition XII. Temminckia 6, 241–294. Holthuis, L. B., and Manning, R. B. (1969). Stomatopoda. In ‘Arthropoda. Treatise on Invertebrate Paleontology’. (Ed. R. C. Moore.) Part R, 4: 535–552. (Geological Society of America and University of Kansas: Lawrence, KS.) Hou, Z., Fu, J., and Li, S. (2007). A molecular phylogeny of the genus Gammarus (Crustacea: Amphipoda) based on mitochondrial and nuclear gene sequences. Molecular Phylogenetics and Evolution 45, 596–611. doi:10.1016/j.ympev.2007.06.006 Lanfear, R., Frandsen, P., Wright, A., Senfeld, T., and Calcott, B. (2016). PartitionFinder 2: new methods for selecting partitioned models of evolution for molecular and morphological phylogenetic analyses. Molecular Biology and Evolution 34, 772–773. Lavery, S., Chan, T. Y., Tam, Y. K., and Chu, K. H. (2004). Phylogenetic relationships and evolutionary history of the shrimp genus Penaeus s.l. derived from mitochondrial DNA. Molecular Phylogenetics and Evolution 31, 39–49. doi:10.1016/j.ympev.2003.07.015 LY Acknowledgements K 5 10 15 20 25 30 35 40 45 50 55 60 15 Q2 20 25 30 35 40 45 50 55 Lee, M., Hugall, A., Lawson, R., and Scanlon, J. (2007). Phylogeny of snakes (Serpentes): combining morphological and molecular data in likelihood, Bayesian and parsimony analyses. Systematics and Biodiversity 5, 371–389. doi:10.1017/S1477200007002290 Lewis, P. O. (2001). A likelihood approach to estimating phylogeny from discrete morphological character data. Systematic Biology 50, 913–925. doi:10.1080/106351501753462876 Linnaeus, C. (1758). ‘Systema naturae per regna tria naturae, secundum classes, ordines, genera, species, cum characteribus, differentiis, synonymis, locis. Ed. 10, Vol. 1.’ (Laurentii Salvii: Holmiae, Sweden.) Maddison, D. R., and Maddison, W. P. (2000). ‘MacClade 4: Analysis of Phylogeny and Character Evolution. Version 4.0.’ (Sinauer Associates: Sunderland, MA.) Manning, R. B. (1968). A revision of the family Squillidae (Crustacea, Stomatopoda), with the description of eight new genera. Bulletin of Marine Science 18, 105–142. Manning, R. B. (1971). ‘Keys to the Species of Oratosquilla (Crustacea: Stomatopoda), with Descriptions of Two New Species.’ (Smithsonian Institution Press: Washington, DC.) Manning, R. B. (1977). A monograph of the West African stomatopod Crustacea. Issue 12 of Atlantide report: scientific results of the Danish Expedition to the coasts of tropical West Africa.’ (Scandinavian Science Press Ltd.: Copenhagen, Denmark.) Manning, R. B. (1995). Stomatopod Crustacea of Vietnam: the legacy of Raoul Serène. Crustacean Research Special No. 4, 1–339. Maynou, F., Abello, P., and Sartor, P. (2004). A review of the fisheries biology of the mantis shrimp, Squilla mantis (L., 1758) (Stomatopoda, Squillidae) in the Mediterranean. Crustaceana 77, 1081–1099. doi:10.1163/ 1568540042900295 Mokady, O., and Brickner, I. (2001). Host-associated speciation in a coralinhabiting barnacle. Molecular Biology and Evolution 18, 975–981. doi:10.1093/oxfordjournals.molbev.a003898 Mokady, O., Rozenblatt, S., Graur, D., and Loya, Y. (1994). Coral-host specificity of Red Sea Lithophaga bivalves: interspecific and intraspecific variation in 12S mitochondrial ribosomal RNA. Molecular Marine Biology and Biotechnology 3, 158–164. Near, T., Pesavento, J., and Cheng, C. (2003). Mitochondrial DNA, morphology, and the phylogenetic relationships of Antarctic icefishes (Notothenioidei: Channichthyidae). Molecular Phylogenetics and Evolution 28, 87–98. doi:10.1016/S1055-7903(03)00029-0 Pileggi, L. G., and Mantelatto, F. L. (2010). Molecular phylogeny of the freshwater prawn genus Macrobrachium (Decapoda, Palaemonidae), with emphasis on the relationships among selected American species. Invertebrate Systematics 24, 194–208. doi:10.1071/IS09043 Porter, M. L., Pérez-Losada, M., and Crandall, K. A. (2005). Model-based multi-locus estimation of decapod phylogeny and divergence times. Molecular Phylogenetics and Evolution 37, 355–369. doi:10.1016/ j.ympev.2005.06.021 Porter, M. L., Zhang, Y. F., Desai, S., Caldwell, R. L., and Cronin, T. W. (2010). Evolution of anatomical and physiological specialization in the compound eyes of stomatopod crustaceans. The Journal of Experimental Biology 213, 3473–3486. doi:10.1242/jeb.046508 Rambaut, A., Drummond, A., Xie, D., Baele, G., and Suchard, M. (2018). Posterior summarization in Bayesian phylogenetics using Tracer 1.7. Systematic Biology, in press. doi:10.1093/sysbio/syy032 Risso, A. (1816). ‘Histoire Naturelle des Crustacés des Environs de Nice.’ (F. G. Levrault: Paris.) Rokas, A., Krüger, D., and Carroll, S. B. (2005). Animal evolution and the molecular signature of radiations compressed in time. Science 310, 1933–1938. doi:10.1126/science.1116759 Ronquist, F., Teslenko, M., van der Mark, P., Ayres, D. L., Darling, A., Hohna, S., Larget, B., Liu, L., Suchard, M. A., and Huelsenbeck, J. P. (2012). MrBayes 3.2: efficient Bayesian phylogenetic inference and model choice across a large model space. Systematic Biology 61, 539–542. doi:10.1093/sysbio/sys029 Ruhfel, B., Stevens, P., and Davis, C. (2013). Combined morphological and molecular phylogeny of the clusioid clade (Malpighiales) and the placement of the ancient Rosid Macrofossil Paleoclusia. International Journal of Plant Sciences 174, 910–936. doi:10.1086/670668 San Jose, M., Doorenweerd, C., Leblanc, L., Barr, N., Geib, S., and Rubinoff, D. (2018). Incongruence between molecules and morphology: a sevengene phylogeny of Dacini fruit flies paves the way for reclassification (Diptera: Tephritidae). Molecular Phylogenetics and Evolution 121, 139–149. doi:10.1016/j.ympev.2017.12.001 Schnabel, K. E., Ahyong, S. T., and Maas, E. W. (2011). Galatheoidea are not monophyletic – molecular and morphological phylogeny of the squat lobsters (Decapoda: Anomura) with recognition of a new superfamily. Molecular Phylogenetics and Evolution 58, 157–168. doi:10.1016/j.ympev.2010.11.011 Stamatakis, A. (2014). RAxML version 8: a tool for phylogenetic analysis and post-analysis of large phylogenies. Bioinformatics 30, 1312–1313. doi:10.1093/bioinformatics/btu033 Stephenson, W. (1953). Three new Stomatopoda (Crustacea) from eastern Australia. Australian Journal of Marine and Freshwater Research 4, 201–218. Van Der Wal, C., and Ahyong, S. T. (2017). Expanding diversity in the mantis shrimps: two new genera from the eastern and western Pacific (Crustacea: Stomatopoda: Squillidae). Nauplius 25, e2017012. doi:10.1590/ 2358-2936e2017012 Van Der Wal, C., Ahyong, S. T., Ho, S. Y. W., and Lo, N. (2017). The evolutionary history of Stomatopoda (Crustacea: Malacostraca) inferred from molecular data. PeerJ 5, e3844. doi:10.7717/peerj.3844 Walsh, P. S., Metzger, D. A., and Higuchi, R. (1991). Chelex-100 as a medium for simple extraction of DNA for PCR-based typing from forensic material. BioTechniques 10, 506–513. Wardiatno, Y., and Mashar, A. (2010). Biological information on the mantis shrimp, Harpiosquilla raphidea (Fabricius 1798) (Stomatopoda, Crustacea) in Indonesia with a highlight of its reproductive aspects. Journal of Tropical Biology & Conservation 7, 65–73. Wiens, J. (2004). The role of morphological data in phylogeny reconstruction. Systematic Biology 53, 653–661. doi:10.1080/1063515 0490472959 Wortley, A., and Scotland, R. (2006). The effect of combining molecular and morphological data in published phylogenetic analyses. Systematic Biology 55, 677–685. doi:10.1080/10635150600899798 Xia, X. (2013). DAMBE5: a comprehensive software package for data analysis in molecular biology and evolution. Molecular Biology and Evolution 30, 1720–1728. doi:10.1093/molbev/mst064 Zhang, D. Z., Ding, G., Ge, B. M., Zhang, H. B., and Tang, B. P. (2012). Development and characterization of microsatellite loci of Oratosquilla oratoria (Crustacea: Squillidae). Conservation Genetics Resources 4, 147–150. doi:10.1007/s12686-011-9495-3 ON 10 C. Van Der Wal et al. PRO OF 5 Invertebrate Systematics LY L www.publish.csiro.au/journals/is 5 10 15 20 25 30 35 40 45 50 55 AUTHOR QUERIES PRO OF ON LY 1. Au: Ahyong 2012 reformatted to journal style for a book reference. 2. Au: Manning 1977 reformatted to journal style for a book reference. 3. Au: is Alcock 1894 given here as a reference?